ID: 1008393278

View in Genome Browser
Species Human (GRCh38)
Location 6:50977901-50977923
Sequence TAGGACCCCCTGAATAATCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008393277_1008393278 -6 Left 1008393277 6:50977884-50977906 CCTTTTATGGTTGCATTTAGGAC No data
Right 1008393278 6:50977901-50977923 TAGGACCCCCTGAATAATCCAGG No data
1008393272_1008393278 7 Left 1008393272 6:50977871-50977893 CCTTCCCATAAGGCCTTTTATGG No data
Right 1008393278 6:50977901-50977923 TAGGACCCCCTGAATAATCCAGG No data
1008393274_1008393278 3 Left 1008393274 6:50977875-50977897 CCCATAAGGCCTTTTATGGTTGC No data
Right 1008393278 6:50977901-50977923 TAGGACCCCCTGAATAATCCAGG No data
1008393271_1008393278 16 Left 1008393271 6:50977862-50977884 CCTTTGTATCCTTCCCATAAGGC No data
Right 1008393278 6:50977901-50977923 TAGGACCCCCTGAATAATCCAGG No data
1008393275_1008393278 2 Left 1008393275 6:50977876-50977898 CCATAAGGCCTTTTATGGTTGCA No data
Right 1008393278 6:50977901-50977923 TAGGACCCCCTGAATAATCCAGG No data
1008393269_1008393278 17 Left 1008393269 6:50977861-50977883 CCCTTTGTATCCTTCCCATAAGG No data
Right 1008393278 6:50977901-50977923 TAGGACCCCCTGAATAATCCAGG No data
1008393268_1008393278 18 Left 1008393268 6:50977860-50977882 CCCCTTTGTATCCTTCCCATAAG No data
Right 1008393278 6:50977901-50977923 TAGGACCCCCTGAATAATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008393278 Original CRISPR TAGGACCCCCTGAATAATCC AGG Intergenic
No off target data available for this crispr