ID: 1008398749

View in Genome Browser
Species Human (GRCh38)
Location 6:51039298-51039320
Sequence TCTAGGGATCAGTAGGGGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008398749_1008398758 -1 Left 1008398749 6:51039298-51039320 CCAATCCCCTACTGATCCCTAGA No data
Right 1008398758 6:51039320-51039342 AGAGGACGGTATTCATGTATGGG No data
1008398749_1008398757 -2 Left 1008398749 6:51039298-51039320 CCAATCCCCTACTGATCCCTAGA No data
Right 1008398757 6:51039319-51039341 GAGAGGACGGTATTCATGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008398749 Original CRISPR TCTAGGGATCAGTAGGGGAT TGG (reversed) Intergenic
No off target data available for this crispr