ID: 1008404467

View in Genome Browser
Species Human (GRCh38)
Location 6:51103346-51103368
Sequence CTGTTCACTCTGATGGTAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008404467_1008404474 29 Left 1008404467 6:51103346-51103368 CCCTCTACCATCAGAGTGAACAG No data
Right 1008404474 6:51103398-51103420 CAACCTACTCATCTGACAAAGGG 0: 7851
1: 5238
2: 3887
3: 3835
4: 2664
1008404467_1008404472 -6 Left 1008404467 6:51103346-51103368 CCCTCTACCATCAGAGTGAACAG No data
Right 1008404472 6:51103363-51103385 GAACAGGCAATGTACAAAATGGG No data
1008404467_1008404473 28 Left 1008404467 6:51103346-51103368 CCCTCTACCATCAGAGTGAACAG No data
Right 1008404473 6:51103397-51103419 GCAACCTACTCATCTGACAAAGG 0: 6170
1: 6483
2: 4919
3: 7430
4: 7056
1008404467_1008404471 -7 Left 1008404467 6:51103346-51103368 CCCTCTACCATCAGAGTGAACAG No data
Right 1008404471 6:51103362-51103384 TGAACAGGCAATGTACAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008404467 Original CRISPR CTGTTCACTCTGATGGTAGA GGG (reversed) Intergenic
No off target data available for this crispr