ID: 1008404471

View in Genome Browser
Species Human (GRCh38)
Location 6:51103362-51103384
Sequence TGAACAGGCAATGTACAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008404466_1008404471 30 Left 1008404466 6:51103309-51103331 CCTGCTTTCTCTTGTGGGCATTT 0: 6385
1: 3430
2: 1387
3: 675
4: 639
Right 1008404471 6:51103362-51103384 TGAACAGGCAATGTACAAAATGG No data
1008404468_1008404471 -8 Left 1008404468 6:51103347-51103369 CCTCTACCATCAGAGTGAACAGG No data
Right 1008404471 6:51103362-51103384 TGAACAGGCAATGTACAAAATGG No data
1008404467_1008404471 -7 Left 1008404467 6:51103346-51103368 CCCTCTACCATCAGAGTGAACAG No data
Right 1008404471 6:51103362-51103384 TGAACAGGCAATGTACAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008404471 Original CRISPR TGAACAGGCAATGTACAAAA TGG Intergenic
No off target data available for this crispr