ID: 1008404472

View in Genome Browser
Species Human (GRCh38)
Location 6:51103363-51103385
Sequence GAACAGGCAATGTACAAAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008404468_1008404472 -7 Left 1008404468 6:51103347-51103369 CCTCTACCATCAGAGTGAACAGG No data
Right 1008404472 6:51103363-51103385 GAACAGGCAATGTACAAAATGGG No data
1008404467_1008404472 -6 Left 1008404467 6:51103346-51103368 CCCTCTACCATCAGAGTGAACAG No data
Right 1008404472 6:51103363-51103385 GAACAGGCAATGTACAAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008404472 Original CRISPR GAACAGGCAATGTACAAAAT GGG Intergenic
No off target data available for this crispr