ID: 1008404473

View in Genome Browser
Species Human (GRCh38)
Location 6:51103397-51103419
Sequence GCAACCTACTCATCTGACAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 32058
Summary {0: 6170, 1: 6483, 2: 4919, 3: 7430, 4: 7056}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008404470_1008404473 21 Left 1008404470 6:51103353-51103375 CCATCAGAGTGAACAGGCAATGT No data
Right 1008404473 6:51103397-51103419 GCAACCTACTCATCTGACAAAGG 0: 6170
1: 6483
2: 4919
3: 7430
4: 7056
1008404468_1008404473 27 Left 1008404468 6:51103347-51103369 CCTCTACCATCAGAGTGAACAGG No data
Right 1008404473 6:51103397-51103419 GCAACCTACTCATCTGACAAAGG 0: 6170
1: 6483
2: 4919
3: 7430
4: 7056
1008404467_1008404473 28 Left 1008404467 6:51103346-51103368 CCCTCTACCATCAGAGTGAACAG No data
Right 1008404473 6:51103397-51103419 GCAACCTACTCATCTGACAAAGG 0: 6170
1: 6483
2: 4919
3: 7430
4: 7056

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008404473 Original CRISPR GCAACCTACTCATCTGACAA AGG Intergenic
Too many off-targets to display for this crispr