ID: 1008404474 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 6:51103398-51103420 |
Sequence | CAACCTACTCATCTGACAAA GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 23475 | |||
Summary | {0: 7851, 1: 5238, 2: 3887, 3: 3835, 4: 2664} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1008404467_1008404474 | 29 | Left | 1008404467 | 6:51103346-51103368 | CCCTCTACCATCAGAGTGAACAG | No data | ||
Right | 1008404474 | 6:51103398-51103420 | CAACCTACTCATCTGACAAAGGG | 0: 7851 1: 5238 2: 3887 3: 3835 4: 2664 |
||||
1008404468_1008404474 | 28 | Left | 1008404468 | 6:51103347-51103369 | CCTCTACCATCAGAGTGAACAGG | No data | ||
Right | 1008404474 | 6:51103398-51103420 | CAACCTACTCATCTGACAAAGGG | 0: 7851 1: 5238 2: 3887 3: 3835 4: 2664 |
||||
1008404470_1008404474 | 22 | Left | 1008404470 | 6:51103353-51103375 | CCATCAGAGTGAACAGGCAATGT | No data | ||
Right | 1008404474 | 6:51103398-51103420 | CAACCTACTCATCTGACAAAGGG | 0: 7851 1: 5238 2: 3887 3: 3835 4: 2664 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1008404474 | Original CRISPR | CAACCTACTCATCTGACAAA GGG | Intergenic | ||
Too many off-targets to display for this crispr |