ID: 1008404474

View in Genome Browser
Species Human (GRCh38)
Location 6:51103398-51103420
Sequence CAACCTACTCATCTGACAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 23475
Summary {0: 7851, 1: 5238, 2: 3887, 3: 3835, 4: 2664}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008404467_1008404474 29 Left 1008404467 6:51103346-51103368 CCCTCTACCATCAGAGTGAACAG No data
Right 1008404474 6:51103398-51103420 CAACCTACTCATCTGACAAAGGG 0: 7851
1: 5238
2: 3887
3: 3835
4: 2664
1008404468_1008404474 28 Left 1008404468 6:51103347-51103369 CCTCTACCATCAGAGTGAACAGG No data
Right 1008404474 6:51103398-51103420 CAACCTACTCATCTGACAAAGGG 0: 7851
1: 5238
2: 3887
3: 3835
4: 2664
1008404470_1008404474 22 Left 1008404470 6:51103353-51103375 CCATCAGAGTGAACAGGCAATGT No data
Right 1008404474 6:51103398-51103420 CAACCTACTCATCTGACAAAGGG 0: 7851
1: 5238
2: 3887
3: 3835
4: 2664

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008404474 Original CRISPR CAACCTACTCATCTGACAAA GGG Intergenic
Too many off-targets to display for this crispr