ID: 1008405095

View in Genome Browser
Species Human (GRCh38)
Location 6:51110117-51110139
Sequence CTGGTTATGTACCATGTGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008405095_1008405097 10 Left 1008405095 6:51110117-51110139 CCTAGCACATGGTACATAACCAG No data
Right 1008405097 6:51110150-51110172 TTGAATGAATTGTGACATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008405095 Original CRISPR CTGGTTATGTACCATGTGCT AGG (reversed) Intergenic
No off target data available for this crispr