ID: 1008405988

View in Genome Browser
Species Human (GRCh38)
Location 6:51119177-51119199
Sequence CAATGGAACCAAAGGGAAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008405988_1008405991 -9 Left 1008405988 6:51119177-51119199 CCTACTTCCCTTTGGTTCCATTG No data
Right 1008405991 6:51119191-51119213 GTTCCATTGCCAGACACATAAGG No data
1008405988_1008405993 -4 Left 1008405988 6:51119177-51119199 CCTACTTCCCTTTGGTTCCATTG No data
Right 1008405993 6:51119196-51119218 ATTGCCAGACACATAAGGAAAGG No data
1008405988_1008405995 14 Left 1008405988 6:51119177-51119199 CCTACTTCCCTTTGGTTCCATTG No data
Right 1008405995 6:51119214-51119236 AAAGGAGATGCTTTCAATTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008405988 Original CRISPR CAATGGAACCAAAGGGAAGT AGG (reversed) Intergenic
No off target data available for this crispr