ID: 1008406256

View in Genome Browser
Species Human (GRCh38)
Location 6:51121722-51121744
Sequence CCGAATACTGCACTTTTCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008406251_1008406256 1 Left 1008406251 6:51121698-51121720 CCTGGAAAATCGGGTCACTCCCA 0: 2569
1: 2059
2: 972
3: 468
4: 327
Right 1008406256 6:51121722-51121744 CCGAATACTGCACTTTTCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008406256 Original CRISPR CCGAATACTGCACTTTTCTG AGG Intergenic
No off target data available for this crispr