ID: 1008407676

View in Genome Browser
Species Human (GRCh38)
Location 6:51136734-51136756
Sequence GAGGGTGAGCAGAAGGAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008407676_1008407689 18 Left 1008407676 6:51136734-51136756 CCACCCTCCTTCTGCTCACCCTC No data
Right 1008407689 6:51136775-51136797 TCTAACCAGTCCCAATGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008407676 Original CRISPR GAGGGTGAGCAGAAGGAGGG TGG (reversed) Intergenic
No off target data available for this crispr