ID: 1008411575

View in Genome Browser
Species Human (GRCh38)
Location 6:51186576-51186598
Sequence ACTACATATGTTATGAAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008411575_1008411578 10 Left 1008411575 6:51186576-51186598 CCTGTTTTCATAACATATGTAGT No data
Right 1008411578 6:51186609-51186631 CATATTTAACAACTGGAGATTGG No data
1008411575_1008411576 3 Left 1008411575 6:51186576-51186598 CCTGTTTTCATAACATATGTAGT No data
Right 1008411576 6:51186602-51186624 TAACCTACATATTTAACAACTGG No data
1008411575_1008411579 25 Left 1008411575 6:51186576-51186598 CCTGTTTTCATAACATATGTAGT No data
Right 1008411579 6:51186624-51186646 GAGATTGGCTAAATATATTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008411575 Original CRISPR ACTACATATGTTATGAAAAC AGG (reversed) Intergenic
No off target data available for this crispr