ID: 1008416280

View in Genome Browser
Species Human (GRCh38)
Location 6:51244576-51244598
Sequence TGGTCCTGATGAGAAGATAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008416280_1008416284 3 Left 1008416280 6:51244576-51244598 CCCCTATCTTCTCATCAGGACCA No data
Right 1008416284 6:51244602-51244624 CAGAACCTAACTTGTCTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008416280 Original CRISPR TGGTCCTGATGAGAAGATAG GGG (reversed) Intergenic