ID: 1008416280 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 6:51244576-51244598 |
| Sequence | TGGTCCTGATGAGAAGATAG GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1008416280_1008416284 | 3 | Left | 1008416280 | 6:51244576-51244598 | CCCCTATCTTCTCATCAGGACCA | No data | ||
| Right | 1008416284 | 6:51244602-51244624 | CAGAACCTAACTTGTCTTCCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1008416280 | Original CRISPR | TGGTCCTGATGAGAAGATAG GGG (reversed) | Intergenic | ||