ID: 1008417248

View in Genome Browser
Species Human (GRCh38)
Location 6:51256295-51256317
Sequence AACCCCATGATATTATTTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008417245_1008417248 30 Left 1008417245 6:51256242-51256264 CCAGGTGTTTTTCTTAGTACTTT No data
Right 1008417248 6:51256295-51256317 AACCCCATGATATTATTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008417248 Original CRISPR AACCCCATGATATTATTTAC TGG Intergenic
No off target data available for this crispr