ID: 1008422624

View in Genome Browser
Species Human (GRCh38)
Location 6:51319960-51319982
Sequence CTCTAGCCATATATGGCACT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008422620_1008422624 12 Left 1008422620 6:51319925-51319947 CCCACTTTACTACACACATTATT No data
Right 1008422624 6:51319960-51319982 CTCTAGCCATATATGGCACTAGG No data
1008422621_1008422624 11 Left 1008422621 6:51319926-51319948 CCACTTTACTACACACATTATTC No data
Right 1008422624 6:51319960-51319982 CTCTAGCCATATATGGCACTAGG No data
1008422619_1008422624 23 Left 1008422619 6:51319914-51319936 CCTTTTAGTCACCCACTTTACTA No data
Right 1008422624 6:51319960-51319982 CTCTAGCCATATATGGCACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008422624 Original CRISPR CTCTAGCCATATATGGCACT AGG Intergenic
No off target data available for this crispr