ID: 1008427328

View in Genome Browser
Species Human (GRCh38)
Location 6:51374584-51374606
Sequence GAATACTTATTGGCCAATAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008427326_1008427328 6 Left 1008427326 6:51374555-51374577 CCAGAAGGTTCAAAATTGATATA No data
Right 1008427328 6:51374584-51374606 GAATACTTATTGGCCAATAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008427328 Original CRISPR GAATACTTATTGGCCAATAA AGG Intergenic
No off target data available for this crispr