ID: 1008428578

View in Genome Browser
Species Human (GRCh38)
Location 6:51388086-51388108
Sequence CAGAGCAAACAAAGGGATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008428570_1008428578 26 Left 1008428570 6:51388037-51388059 CCTCCATGAATAAACAACATTGC No data
Right 1008428578 6:51388086-51388108 CAGAGCAAACAAAGGGATGAAGG No data
1008428574_1008428578 -5 Left 1008428574 6:51388068-51388090 CCCAGTGAAAGAGAAAGGCAGAG No data
Right 1008428578 6:51388086-51388108 CAGAGCAAACAAAGGGATGAAGG No data
1008428575_1008428578 -6 Left 1008428575 6:51388069-51388091 CCAGTGAAAGAGAAAGGCAGAGC No data
Right 1008428578 6:51388086-51388108 CAGAGCAAACAAAGGGATGAAGG No data
1008428569_1008428578 27 Left 1008428569 6:51388036-51388058 CCCTCCATGAATAAACAACATTG No data
Right 1008428578 6:51388086-51388108 CAGAGCAAACAAAGGGATGAAGG No data
1008428571_1008428578 23 Left 1008428571 6:51388040-51388062 CCATGAATAAACAACATTGCAGT No data
Right 1008428578 6:51388086-51388108 CAGAGCAAACAAAGGGATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008428578 Original CRISPR CAGAGCAAACAAAGGGATGA AGG Intergenic
No off target data available for this crispr