ID: 1008429165

View in Genome Browser
Species Human (GRCh38)
Location 6:51394555-51394577
Sequence CAACTTTACCAGATGAAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008429161_1008429165 8 Left 1008429161 6:51394524-51394546 CCTTGGAGATCTGCTAAGAAATC No data
Right 1008429165 6:51394555-51394577 CAACTTTACCAGATGAAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008429165 Original CRISPR CAACTTTACCAGATGAAGCT TGG Intergenic
No off target data available for this crispr