ID: 1008430894

View in Genome Browser
Species Human (GRCh38)
Location 6:51415432-51415454
Sequence CTGTAACTAGGTGGTCTTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008430894_1008430899 -7 Left 1008430894 6:51415432-51415454 CCATTAAGACCACCTAGTTACAG No data
Right 1008430899 6:51415448-51415470 GTTACAGCCTATGAGGGCTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008430894 Original CRISPR CTGTAACTAGGTGGTCTTAA TGG (reversed) Intergenic
No off target data available for this crispr