ID: 1008434106

View in Genome Browser
Species Human (GRCh38)
Location 6:51455023-51455045
Sequence CTAGATCACTAGTTCTTTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008434094_1008434106 24 Left 1008434094 6:51454976-51454998 CCATGGCTGTTATTTTCCCAGAT No data
Right 1008434106 6:51455023-51455045 CTAGATCACTAGTTCTTTACTGG No data
1008434103_1008434106 7 Left 1008434103 6:51454993-51455015 CCAGATGGCTTGGGGAGGGGATT No data
Right 1008434106 6:51455023-51455045 CTAGATCACTAGTTCTTTACTGG No data
1008434102_1008434106 8 Left 1008434102 6:51454992-51455014 CCCAGATGGCTTGGGGAGGGGAT No data
Right 1008434106 6:51455023-51455045 CTAGATCACTAGTTCTTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008434106 Original CRISPR CTAGATCACTAGTTCTTTAC TGG Intergenic
No off target data available for this crispr