ID: 1008440063

View in Genome Browser
Species Human (GRCh38)
Location 6:51522588-51522610
Sequence GACCTAGGGGAAGTGGCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008440063_1008440073 10 Left 1008440063 6:51522588-51522610 CCTGGAGCCACTTCCCCTAGGTC No data
Right 1008440073 6:51522621-51522643 GAACCTCCCCTTGAAGCTCTGGG No data
1008440063_1008440072 9 Left 1008440063 6:51522588-51522610 CCTGGAGCCACTTCCCCTAGGTC No data
Right 1008440072 6:51522620-51522642 GGAACCTCCCCTTGAAGCTCTGG No data
1008440063_1008440074 11 Left 1008440063 6:51522588-51522610 CCTGGAGCCACTTCCCCTAGGTC No data
Right 1008440074 6:51522622-51522644 AACCTCCCCTTGAAGCTCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008440063 Original CRISPR GACCTAGGGGAAGTGGCTCC AGG (reversed) Intergenic
No off target data available for this crispr