ID: 1008440064

View in Genome Browser
Species Human (GRCh38)
Location 6:51522595-51522617
Sequence TTTATTGGACCTAGGGGAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008440064_1008440074 4 Left 1008440064 6:51522595-51522617 CCACTTCCCCTAGGTCCAATAAA No data
Right 1008440074 6:51522622-51522644 AACCTCCCCTTGAAGCTCTGGGG No data
1008440064_1008440073 3 Left 1008440064 6:51522595-51522617 CCACTTCCCCTAGGTCCAATAAA No data
Right 1008440073 6:51522621-51522643 GAACCTCCCCTTGAAGCTCTGGG No data
1008440064_1008440072 2 Left 1008440064 6:51522595-51522617 CCACTTCCCCTAGGTCCAATAAA No data
Right 1008440072 6:51522620-51522642 GGAACCTCCCCTTGAAGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008440064 Original CRISPR TTTATTGGACCTAGGGGAAG TGG (reversed) Intergenic
No off target data available for this crispr