ID: 1008440072

View in Genome Browser
Species Human (GRCh38)
Location 6:51522620-51522642
Sequence GGAACCTCCCCTTGAAGCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008440064_1008440072 2 Left 1008440064 6:51522595-51522617 CCACTTCCCCTAGGTCCAATAAA No data
Right 1008440072 6:51522620-51522642 GGAACCTCCCCTTGAAGCTCTGG No data
1008440062_1008440072 10 Left 1008440062 6:51522587-51522609 CCCTGGAGCCACTTCCCCTAGGT No data
Right 1008440072 6:51522620-51522642 GGAACCTCCCCTTGAAGCTCTGG No data
1008440069_1008440072 -5 Left 1008440069 6:51522602-51522624 CCCTAGGTCCAATAAAGGGGAAC No data
Right 1008440072 6:51522620-51522642 GGAACCTCCCCTTGAAGCTCTGG No data
1008440068_1008440072 -4 Left 1008440068 6:51522601-51522623 CCCCTAGGTCCAATAAAGGGGAA No data
Right 1008440072 6:51522620-51522642 GGAACCTCCCCTTGAAGCTCTGG No data
1008440070_1008440072 -6 Left 1008440070 6:51522603-51522625 CCTAGGTCCAATAAAGGGGAACC No data
Right 1008440072 6:51522620-51522642 GGAACCTCCCCTTGAAGCTCTGG No data
1008440063_1008440072 9 Left 1008440063 6:51522588-51522610 CCTGGAGCCACTTCCCCTAGGTC No data
Right 1008440072 6:51522620-51522642 GGAACCTCCCCTTGAAGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008440072 Original CRISPR GGAACCTCCCCTTGAAGCTC TGG Intergenic
No off target data available for this crispr