ID: 1008443407

View in Genome Browser
Species Human (GRCh38)
Location 6:51559073-51559095
Sequence TCCCACTGGTTGCTGAGTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008443402_1008443407 -4 Left 1008443402 6:51559054-51559076 CCGAAAGTCAAAACTCCCATCCC No data
Right 1008443407 6:51559073-51559095 TCCCACTGGTTGCTGAGTAAGGG No data
1008443401_1008443407 -3 Left 1008443401 6:51559053-51559075 CCCGAAAGTCAAAACTCCCATCC No data
Right 1008443407 6:51559073-51559095 TCCCACTGGTTGCTGAGTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008443407 Original CRISPR TCCCACTGGTTGCTGAGTAA GGG Intergenic
No off target data available for this crispr