ID: 1008449300

View in Genome Browser
Species Human (GRCh38)
Location 6:51631755-51631777
Sequence TGGAGACTTGTAGTCACTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 154}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008449300_1008449303 -1 Left 1008449300 6:51631755-51631777 CCCTCAGTGACTACAAGTCTCCA 0: 1
1: 0
2: 2
3: 9
4: 154
Right 1008449303 6:51631777-51631799 AGCTTTAAAAAATTAAAAAATGG No data
1008449300_1008449306 24 Left 1008449300 6:51631755-51631777 CCCTCAGTGACTACAAGTCTCCA 0: 1
1: 0
2: 2
3: 9
4: 154
Right 1008449306 6:51631802-51631824 TCCACTTCTGGGAAATATTTAGG 0: 1
1: 0
2: 0
3: 35
4: 276
1008449300_1008449305 13 Left 1008449300 6:51631755-51631777 CCCTCAGTGACTACAAGTCTCCA 0: 1
1: 0
2: 2
3: 9
4: 154
Right 1008449305 6:51631791-51631813 AAAAAATGGCATCCACTTCTGGG 0: 1
1: 0
2: 3
3: 29
4: 274
1008449300_1008449304 12 Left 1008449300 6:51631755-51631777 CCCTCAGTGACTACAAGTCTCCA 0: 1
1: 0
2: 2
3: 9
4: 154
Right 1008449304 6:51631790-51631812 TAAAAAATGGCATCCACTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008449300 Original CRISPR TGGAGACTTGTAGTCACTGA GGG (reversed) Intronic
907061960 1:51436247-51436269 TGGAGATGGGAAGTCACTGAGGG + Intronic
907387021 1:54132634-54132656 TGGATAGTTGTGGTCACTGGTGG - Intergenic
910649969 1:89556113-89556135 TGGAGATTTTCAGTCACTAACGG + Intronic
915680130 1:157573303-157573325 TGGAGGCTTGTGGGCACTTAGGG + Intergenic
915735152 1:158079849-158079871 TGGAGACTTGTAAACTGTGAAGG + Intronic
917957391 1:180114085-180114107 CAGAGACCTGTAGTCACAGAAGG - Exonic
921393949 1:214648785-214648807 TGGAGAGTTGCAGTTACTGTTGG + Exonic
922729037 1:227940540-227940562 TGCAGACCTGGAGTCACTGTGGG - Intronic
923601713 1:235409445-235409467 TGGAGATTTGTTGTTATTGATGG + Intronic
924876646 1:248112025-248112047 TGGGGACTTCTAGGAACTGAGGG + Intergenic
1068408269 10:56622293-56622315 TAGAGACTTCTAGTCTCTAAAGG + Intergenic
1069152161 10:64976601-64976623 TGGGGCCCTGTAGTAACTGAAGG + Intergenic
1069943377 10:71970201-71970223 TGGAGACAAGAAGTCACTGGTGG - Intronic
1070984120 10:80673521-80673543 TGGGGACATGTAGTCACAGCTGG - Intergenic
1077054558 11:584619-584641 TGGAGACCTGGAGCCCCTGAGGG + Intronic
1080604400 11:33852852-33852874 TGGAGAATTGTATTTATTGATGG + Intergenic
1082872264 11:57954063-57954085 TGCATACTTGTAGTCACAGGGGG + Intergenic
1086829393 11:91540958-91540980 TGGAGATCTATAGTGACTGATGG + Intergenic
1088623396 11:111709719-111709741 AGGAGTCTTGTGATCACTGAGGG - Intronic
1089452185 11:118606551-118606573 TGGAGACTCTTCTTCACTGAAGG - Exonic
1090473171 11:126997880-126997902 TGGACATTTGTTGTCTCTGAGGG + Intronic
1090655582 11:128841895-128841917 TGGGGACTTGAGGTCAGTGAGGG - Intronic
1092984523 12:13833186-13833208 TGTAGACTTGTATTAACTCATGG + Intronic
1092990750 12:13896583-13896605 TGGAGTTTTGTAGTGACTTAAGG - Intronic
1093365603 12:18292874-18292896 TGGAGACTTACAGTCATTAAGGG + Intronic
1096035139 12:48460377-48460399 TGGAGACATATAAACACTGAAGG + Intergenic
1098489961 12:71064080-71064102 AGGAGATTTGAAGTCACAGATGG + Intronic
1098602966 12:72355287-72355309 TGGAGAGTTGTAGTTAGAGAAGG + Intronic
1100714023 12:97287148-97287170 TGGGGAAATGTAGTCAATGATGG + Intergenic
1101101365 12:101397198-101397220 TGGAGACTTTTATACACTGTTGG - Intronic
1102749047 12:115276239-115276261 TGAGGACTTGGAGACACTGATGG - Intergenic
1105209249 13:18248062-18248084 TGGAGAATTGGCCTCACTGAAGG + Intergenic
1109575875 13:64257941-64257963 AAGTGACTTATAGTCACTGAAGG - Intergenic
1118816319 14:69316757-69316779 TGGGGGCTTGTAGTCTGTGAGGG + Intronic
1120003740 14:79333295-79333317 AGGAGCCTTGCAGTCACTGAAGG - Intronic
1123931258 15:25172776-25172798 TGGAGACCTGGAGGCCCTGAAGG + Intergenic
1123932556 15:25178891-25178913 TGGAGACCTGGAGGCCCTGAAGG + Intergenic
1123933371 15:25182538-25182560 TGGAGACCTGGAGGCCCTGAAGG + Intergenic
1123933796 15:25184459-25184481 TGGAGACCTGGAGTCCTTGAAGG + Intergenic
1123936149 15:25195074-25195096 TGGAGACCTGGAGGCTCTGAGGG + Intergenic
1123938024 15:25203380-25203402 TGGAGACCTGGAGGCCCTGAAGG + Intergenic
1123940370 15:25213801-25213823 TGGAGACTTCAAGGCCCTGAAGG + Intergenic
1123942502 15:25223400-25223422 TGGAGACCTGGAGGCCCTGAAGG + Intergenic
1123943753 15:25229120-25229142 TGGAGACCTGGAGGCTCTGAAGG + Intergenic
1123947431 15:25245630-25245652 TGGAGACCTGGAGGCCCTGAAGG + Intergenic
1124005274 15:25791006-25791028 TGGAGACTCTTAGATACTGACGG - Intronic
1127767340 15:62199636-62199658 TGGAGAGTTTTAGTCAGGGATGG - Intergenic
1128682242 15:69660533-69660555 TGGAGGCGTGGAGTCAATGACGG + Intergenic
1130994027 15:88894413-88894435 GGGGGACTTGTACTCACGGAAGG - Intronic
1135257428 16:20952213-20952235 TGGAGACTGTGAGTCACTCAAGG + Intronic
1136286501 16:29247228-29247250 TGGAGACTTGGGGTGCCTGAAGG - Intergenic
1141632640 16:85296864-85296886 TGGAGTCTTGCAGTCTGTGAGGG + Intergenic
1142033586 16:87850479-87850501 TGGTGACTCGCAGTCACCGATGG - Intronic
1145890162 17:28408458-28408480 TGGAGACTTGAAGGAAGTGAGGG - Intergenic
1152137885 17:78515996-78516018 TGGAAACTGCTAGTCATTGAGGG + Intronic
1153296778 18:3553976-3553998 TGGAGTCTTAGAGTCACTAATGG + Intronic
1153617801 18:6950632-6950654 TCAAGACTTGTAGTCTCTGGGGG + Intronic
1153651295 18:7242506-7242528 CAGAGACTTGTAGGCAGTGAAGG + Intergenic
1160158656 18:76453353-76453375 TGAAGTCCTGTGGTCACTGAGGG + Intronic
1162223846 19:9203044-9203066 AGACAACTTGTAGTCACTGATGG + Intergenic
1163898673 19:20081521-20081543 AGGAGACTTGTAGACACTTGTGG - Intronic
1163904829 19:20143321-20143343 AGGAGACTTGTAGATACTGTGGG + Intergenic
1164101550 19:22058919-22058941 AGGAGACTTGTAGACACTTGTGG - Intronic
1165399216 19:35586939-35586961 TGGAGACCTGCAGTCACTGAGGG - Intergenic
1166792251 19:45405166-45405188 TTGGGACTTGTAGTCCCGGAGGG + Intronic
930620066 2:53634523-53634545 TGGTGACTGGTTGTCAGTGAGGG - Intronic
931507290 2:62943795-62943817 CAGAGACTTGTAGTCACTGAGGG - Exonic
933133000 2:78696929-78696951 TGGACACTTCTTGCCACTGATGG + Intergenic
934070063 2:88375532-88375554 TGGAGACTGGTAATCACACAAGG + Intergenic
935221719 2:101021056-101021078 GGGAGGCTGGTAGGCACTGAGGG - Intronic
937136272 2:119556269-119556291 TGGAGACTAGTGGAGACTGAAGG - Intronic
939994483 2:148907326-148907348 TGGAGAGTTGAAGTAACTGCAGG - Intronic
940975939 2:159944362-159944384 TAGAAAATTCTAGTCACTGATGG - Intronic
941456944 2:165720464-165720486 TGGAGGCATGTAGGCACAGATGG + Intergenic
942848689 2:180456871-180456893 TGGAGACTTGGAGTCCCAGTAGG - Intergenic
943977194 2:194499025-194499047 TTGAGTCTTGTATTTACTGAGGG - Intergenic
944335072 2:198523172-198523194 TGGAGACTGCTAGTCACTTAAGG + Intronic
1169266113 20:4168169-4168191 TGGAGACTTCTGGTCCCTGAGGG - Intronic
1171290419 20:23979775-23979797 TGGAGAATTGGCCTCACTGAAGG + Intergenic
1174935779 20:54866558-54866580 TGGTGGCTTGAAGTCAGTGATGG - Intergenic
1175653100 20:60745989-60746011 AGGAAACTTATAGTCACAGAGGG + Intergenic
1180767010 22:18351235-18351257 TGGAGAATTGGCCTCACTGAAGG - Intergenic
1180779303 22:18511144-18511166 TGGAGAATTGGCCTCACTGAAGG + Intergenic
1180812020 22:18768464-18768486 TGGAGAATTGGCCTCACTGAAGG + Intergenic
1181198175 22:21202708-21202730 TGGAGAATTGGCCTCACTGAAGG + Intergenic
1181401569 22:22653096-22653118 TGGAGAATTGGCCTCACTGAAGG - Intergenic
1181549064 22:23626087-23626109 TGGAGACTGGGAGTCCCTCAGGG + Intronic
1181647983 22:24244021-24244043 TGGAGAATTGGCCTCACTGAAGG + Intronic
1181703530 22:24634193-24634215 TGGAGAATTGGCCTCACTGAAGG - Intergenic
1181799601 22:25336072-25336094 TGGAGACTGGGAGTCCCTCAGGG - Intergenic
1184650362 22:45916794-45916816 TGGAGTCCTGTAGCCACAGAAGG - Intergenic
1203228632 22_KI270731v1_random:92129-92151 TGGAGAATTGGCCTCACTGAAGG - Intergenic
949454204 3:4221285-4221307 TAGAGACATGTGGACACTGATGG + Intronic
950316688 3:12007190-12007212 TGGAGACTAGAAGCCTCTGATGG + Intronic
950724207 3:14906029-14906051 TGAAGCCTGGCAGTCACTGAAGG - Intronic
951258469 3:20479174-20479196 TGGAGACTTTTAGTTATTTAGGG + Intergenic
951732271 3:25823568-25823590 TGGAAACTAGAAGTAACTGAAGG + Intergenic
953288494 3:41637216-41637238 AGGAGACTGGTGGTTACTGAGGG - Intronic
953408153 3:42670363-42670385 TGCAGACTTGTGTTCTCTGAGGG - Intergenic
953774116 3:45800992-45801014 TGGTGACTGGGAGCCACTGAGGG - Intergenic
959743561 3:109749534-109749556 TGGACATTTGTAGGCACTGAAGG + Intergenic
961781838 3:129325065-129325087 TGGAGCCCTGTAGTCCCTGTAGG - Intergenic
962392284 3:134983133-134983155 TGGAGACTGAAAGTCACTAAGGG - Intronic
963041025 3:141069956-141069978 TGGAAGCATGTATTCACTGAGGG + Intronic
963342663 3:144055941-144055963 AGGAGAATCATAGTCACTGAAGG + Intergenic
964737292 3:159929874-159929896 TGGAGTCCTGCTGTCACTGAGGG - Intergenic
966300734 3:178476798-178476820 TAGAGACTTGGAGTCACTCTAGG + Intronic
966960180 3:184927755-184927777 TAGAGACTGGTAGTTACTAAGGG - Intronic
970245195 4:14054240-14054262 TAGAGACTTTTATACACTGATGG + Intergenic
970797872 4:19936031-19936053 TGAAGACTTGTTGTCTCGGAGGG - Intergenic
972615455 4:40694017-40694039 TGGAGACTTGAAGGAAATGAGGG + Intergenic
974378846 4:61111618-61111640 TGGAGACTTTTAGTCTCTACAGG + Intergenic
977522431 4:98101793-98101815 TTGAGAATTGTGGTTACTGAGGG - Intronic
984948966 4:184992489-184992511 TGCAGACATGTGTTCACTGACGG + Intergenic
985571372 5:647388-647410 TGGAGACCTGTGGCCACTGTGGG + Intronic
987109653 5:14673144-14673166 TGGCGATTTGTAATAACTGATGG + Intronic
987625629 5:20396103-20396125 TGGAAACTTTAATTCACTGAAGG + Intronic
989178583 5:38554949-38554971 TGGAGACTTGTATTCTCTTCTGG - Intronic
993100259 5:83529794-83529816 TGGTGCTTTCTAGTCACTGAAGG - Intronic
994518746 5:100802300-100802322 AGGAAACTTATAGTCACTGGTGG + Intergenic
996540061 5:124621449-124621471 TAGGGACTGGGAGTCACTGATGG - Intergenic
998279442 5:140791105-140791127 TAGAGACTTGTGGTCAGTGAAGG + Intronic
998978549 5:147674975-147674997 TTGACACATGGAGTCACTGATGG + Intronic
1002960446 6:1909531-1909553 TGGGGCCCAGTAGTCACTGAGGG + Intronic
1004947808 6:20635202-20635224 TGGACAATTGGAGGCACTGATGG + Intronic
1006042977 6:31270653-31270675 TGGAAAGTTCTAGTCTCTGAGGG + Intronic
1006434722 6:34020212-34020234 AGGGGACTGGTAGTCCCTGAGGG + Intronic
1006826133 6:36937680-36937702 TGGAGACTGGCAGGCACAGAGGG - Intergenic
1007212467 6:40206399-40206421 TGGAGGCTTGGAGTCCCTGTGGG + Intergenic
1007393092 6:41561724-41561746 TGAATACTGGTAGGCACTGATGG - Intronic
1008449300 6:51631755-51631777 TGGAGACTTGTAGTCACTGAGGG - Intronic
1008574671 6:52848790-52848812 TGGAGACTTTGGGGCACTGAAGG + Intronic
1008577354 6:52873942-52873964 TGGAGACCTGAGGGCACTGAAGG + Intronic
1011249335 6:85354128-85354150 TGGAGACCTCTACTCCCTGAGGG - Intergenic
1012603741 6:101131526-101131548 TAGAAACTTGGAGTCAGTGATGG - Intergenic
1013781127 6:113729709-113729731 TAGAGACTTGAAGTCAGTAAAGG - Intergenic
1014327617 6:120018509-120018531 TGGACCCTTTTAGTCACGGATGG + Intergenic
1015107146 6:129550433-129550455 TGGAAACTAGTATTCACTTAGGG - Intergenic
1017529133 6:155270247-155270269 TGCTGACTTGGCGTCACTGATGG - Intronic
1019703805 7:2488022-2488044 TGGCGACCTGTACTCACTGGGGG - Intergenic
1020253975 7:6491453-6491475 TAGTGATTTGTGGTCACTGATGG + Intergenic
1021987976 7:26115517-26115539 TGGAACCGTGTTGTCACTGATGG - Intergenic
1024462236 7:49670588-49670610 TGGGGAGTTGGAGTCACTGAGGG - Intergenic
1027446270 7:78276867-78276889 AGGAGACTTGTAAACATTGAGGG + Intronic
1027940994 7:84679140-84679162 TGGAGGCTTGGAGCCAATGAGGG + Intergenic
1028840203 7:95421330-95421352 CTGAGACTTGTATTCACAGAAGG + Intronic
1032073185 7:128822350-128822372 TGGAGAAATGGAGTGACTGAGGG + Intergenic
1033603114 7:142903505-142903527 TGGAGACTTGTAGCCAGGAAAGG + Intergenic
1036710278 8:11074062-11074084 TGGAGACTTTCAGTTGCTGAAGG + Intronic
1041230260 8:55743300-55743322 TGGAGACTTATTGTCACTACAGG - Intronic
1044494894 8:92865396-92865418 TGGGGGCTTAGAGTCACTGATGG - Intergenic
1044757250 8:95477046-95477068 TGCAGAGTTGTAGAGACTGATGG + Intergenic
1045444593 8:102247399-102247421 TAGAAACTTGTAGTCATTGCTGG - Intergenic
1047889458 8:129291674-129291696 TGGAGACTGGAAGTCTGTGATGG - Intergenic
1051398180 9:16649592-16649614 TTCAAGCTTGTAGTCACTGATGG - Intronic
1054823204 9:69544825-69544847 TGGAGACTTATATTTACTGAAGG - Intronic
1058915619 9:109561602-109561624 TGGCCACTTGTAGTCATTGGGGG - Intergenic
1060449370 9:123722610-123722632 TGGACCCTTGTAGTCACAGCTGG - Intronic
1060870419 9:127035357-127035379 TGGAGACTTGGATCAACTGAGGG + Intronic
1060894750 9:127210473-127210495 CGGAGACTTGGAGACTCTGAGGG + Intronic
1194248904 X:91548742-91548764 TGGAGCCTTGTAGTTATTGAAGG - Intergenic
1196182900 X:112714354-112714376 TGAAGTCATGTGGTCACTGAGGG - Intergenic
1197099823 X:122639185-122639207 TGGAGAGTGGTAGTTTCTGATGG + Intergenic
1198301897 X:135341725-135341747 TGCATATTTGAAGTCACTGATGG - Intronic
1199205893 X:145147677-145147699 TCTAGAGTTGTACTCACTGAAGG - Intergenic
1200567914 Y:4790279-4790301 TGGAGCCTTGTAGTTATTGAAGG - Intergenic