ID: 1008453731

View in Genome Browser
Species Human (GRCh38)
Location 6:51684065-51684087
Sequence CTTTCAGAATAGCTGGAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 286
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 262}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008453731_1008453734 29 Left 1008453731 6:51684065-51684087 CCATGTTCCAGCTATTCTGAAAG 0: 1
1: 0
2: 2
3: 21
4: 262
Right 1008453734 6:51684117-51684139 AATTATCATAGCAAACTGAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008453731 Original CRISPR CTTTCAGAATAGCTGGAACA TGG (reversed) Intronic
905714726 1:40138793-40138815 TATTCACAATAGCTGAAACATGG + Intergenic
905765842 1:40600012-40600034 TATTCAGAATAGCTAAAACATGG - Intergenic
907178299 1:52546265-52546287 CATTCACAATAGCTAAAACATGG + Intronic
908180568 1:61600703-61600725 CATTCACAATAGCTAAAACATGG + Intergenic
909223808 1:72992319-72992341 CTTCCAGAAAAGTTGGAAAAGGG + Intergenic
909805872 1:79873669-79873691 ATTTCAGAATATATAGAACAAGG - Intergenic
911048832 1:93652159-93652181 CTTTCAGAACAGAATGAACAAGG - Intronic
911150109 1:94590308-94590330 CTTTCAGCATATCTGCTACACGG + Intergenic
911645231 1:100330607-100330629 CTTTCGGTAGAGCTGGAAGAAGG - Intergenic
912458894 1:109818346-109818368 CCTTCAGAAAACCTGGACCAGGG + Intergenic
913036617 1:114971966-114971988 TTTTCAGAATAGTTTGAGCAGGG + Intronic
913084996 1:115428761-115428783 CTTTCATAGAAGCTGGAATATGG + Intergenic
913251371 1:116914366-116914388 CTTCCATAGTAGCTGGCACATGG - Intronic
913405664 1:118488220-118488242 CTTTCAGAAAAGATGTAAGAAGG - Intergenic
913458109 1:119054619-119054641 CATTCACAATAGCTGAAAGATGG + Intronic
916416921 1:164600934-164600956 CTCTCAGAATAGCAGACACAGGG + Intronic
916559804 1:165924916-165924938 CCTTCAGAACAGCTGGAGGACGG + Intergenic
917260789 1:173165832-173165854 TATTCACAATAGCTGAAACATGG - Intergenic
917323165 1:173804935-173804957 CTTTCATAATTTCTTGAACAAGG - Intronic
918231876 1:182541499-182541521 TATTCACAATAGCTGGAATATGG - Intronic
918447720 1:184631610-184631632 ATTTCAGAAGAGCAGGAAGAAGG + Intergenic
919260992 1:195193321-195193343 ATTGCACAATAGCTGGAGCATGG + Intergenic
920593731 1:207248070-207248092 CTTTCAGAGAATCTGGAATAAGG - Intergenic
921778361 1:219129675-219129697 CTTCCAGCATATCTGGCACATGG - Intergenic
923507078 1:234613233-234613255 CTATCAGAAAAGCAGGAATAAGG + Intergenic
924880881 1:248161209-248161231 CCTTCAAAATATCTGTAACATGG - Intergenic
1063242140 10:4181786-4181808 TTTTCAGAATAACAGGAAAAGGG - Intergenic
1063553120 10:7052059-7052081 CTACCAGCATGGCTGGAACAAGG - Intergenic
1064988837 10:21238032-21238054 CTACCAGAATTCCTGGAACACGG + Intergenic
1065024752 10:21529719-21529741 CTTTCAGTATTGCTGCATCATGG + Intergenic
1067234615 10:44437243-44437265 CAGTCAGTGTAGCTGGAACAGGG - Intergenic
1067487187 10:46661754-46661776 ATTACAAAATAGCTGGAAGAGGG - Intergenic
1067607618 10:47680253-47680275 ATTACAAAATAGCTGGAAGAGGG + Intergenic
1069701285 10:70428324-70428346 CATTCAGAATGGATGGAACTGGG - Exonic
1070279118 10:75036082-75036104 CTTTCCCAAGAGCTGGAATATGG + Intergenic
1070662266 10:78315652-78315674 ATTTTGGAATAGCTGGAAAAAGG - Intergenic
1070843556 10:79504605-79504627 CTTGCAAAATAGCTGGTAGATGG - Intergenic
1070930111 10:80254995-80255017 CTTGCAAAATAGCTGGTAGATGG + Intergenic
1071451798 10:85799838-85799860 ATTTCAAAATAGCTAGAAGAGGG + Intronic
1071623175 10:87141618-87141640 ATTACAAAATAGCTGGAAGAGGG + Intronic
1071873959 10:89823731-89823753 CTCCCAGAATGGCTGGAAAATGG + Intergenic
1074897607 10:117790899-117790921 CTCTCAGAAGAGCTGGGAGAGGG + Intergenic
1076281738 10:129252194-129252216 ATCTCTGAAGAGCTGGAACAGGG + Intergenic
1077878023 11:6323904-6323926 CTCTCTGGATATCTGGAACAAGG + Intergenic
1078275042 11:9835508-9835530 CTTTCTGAGTAGCTGGGACTAGG - Intronic
1080324479 11:31054215-31054237 CTTTTACAATAGCTGAAAAAAGG + Intronic
1081350141 11:42042153-42042175 ATTTCAGAATACCTGAAACTAGG + Intergenic
1082675491 11:56095965-56095987 TTTTCAGAATGGCTAGAATATGG + Intergenic
1086921199 11:92589139-92589161 CTTTTTTATTAGCTGGAACATGG - Intronic
1087044905 11:93836807-93836829 TTTGCAGAGTACCTGGAACATGG + Intronic
1087283969 11:96244145-96244167 ATTTCAAAACATCTGGAACACGG - Intronic
1087840396 11:102914785-102914807 CTCCCAGAATAGTTGGAACATGG - Intergenic
1087903137 11:103665161-103665183 ATATCAGAATCTCTGGAACAAGG - Intergenic
1089095550 11:115917240-115917262 CTTTCTGAATGTTTGGAACATGG - Intergenic
1090847947 11:130546329-130546351 CTTCCAGAATAGCTGAATCCTGG + Intergenic
1090898585 11:131004379-131004401 CTTCCTGAGTAGCTGGAACTGGG + Intergenic
1093121765 12:15279359-15279381 CTCCCAGAATAGCTGGAAGGAGG + Intronic
1094169857 12:27480225-27480247 CTGCCAGCACAGCTGGAACAAGG - Intronic
1095266060 12:40159262-40159284 TTTTCAAAATGGCAGGAACACGG - Intergenic
1096930394 12:55201763-55201785 TTTTCAGAATAGTTTGAATAGGG - Intergenic
1097296806 12:57974289-57974311 CATTCACAATAGCTAAAACATGG + Intergenic
1099796483 12:87407512-87407534 ACTACACAATAGCTGGAACATGG + Intergenic
1100352265 12:93795838-93795860 CTTGTAAAATAGCTAGAACAAGG + Intronic
1100385793 12:94103579-94103601 CATTCGGCATAGCTGGACCATGG + Intergenic
1100608906 12:96174511-96174533 ATTTCAAAATAGCTAGAAAAGGG - Intergenic
1101278556 12:103227226-103227248 CTTCCAGAAAAGTGGGAACAGGG + Intergenic
1101759080 12:107644501-107644523 CTCTCAGAATACCTGGAGAAGGG + Intronic
1101815506 12:108143242-108143264 ATTTCAGAATTGCTGGAACTGGG - Intronic
1104133448 12:125916364-125916386 CTACCAGCATGGCTGGAACAAGG + Intergenic
1104381513 12:128311983-128312005 CTTTCAGCACAGCTGGAAGTTGG - Intronic
1106950793 13:34881363-34881385 TATCCAGAATAGCTGGAATAAGG - Intergenic
1107200465 13:37709813-37709835 CATTCAGAATTTCTGGTACAAGG + Intronic
1107216220 13:37922000-37922022 ATTTCAAAGTAGCTGGAAGAAGG - Intergenic
1107796934 13:44062571-44062593 TTTTTATAACAGCTGGAACATGG + Intergenic
1108198459 13:48018782-48018804 TATTCAGAATAGCTAAAACAAGG - Intergenic
1108475176 13:50809192-50809214 CTTTCTAAATATCTGGTACAAGG - Intronic
1109371861 13:61432572-61432594 CTTTCAGAATATCTGAAACCAGG + Intergenic
1109773486 13:67007901-67007923 CTTTTAGAACAACTGGTACATGG + Intronic
1110341680 13:74399270-74399292 CTTTAAGGTTAGCTGCAACATGG - Intergenic
1113247615 13:108415967-108415989 TATTCACAATAGCAGGAACATGG - Intergenic
1113762559 13:112859658-112859680 GTTTCAGAAGACATGGAACAAGG - Intronic
1115614253 14:35078258-35078280 CTTTCACAGTACCTGGCACATGG + Intronic
1115918746 14:38347416-38347438 TTTTGAGAATAGTTTGAACAAGG - Intergenic
1115953947 14:38755322-38755344 CTTTCACTATAGCTTGAAGAGGG + Intergenic
1115954069 14:38757428-38757450 CTTTCACTATAGCTTGAAGAGGG - Intergenic
1116468577 14:45261419-45261441 CTTTAAGAATGCCTGTAACATGG - Intergenic
1116644183 14:47505327-47505349 ATTACAGAATAGCTAGAAAAGGG + Intronic
1116815740 14:49581898-49581920 CCTTCTGAGTAGCTGGGACATGG - Intronic
1118390991 14:65295170-65295192 CTTTCAGGATTGCTGCAGCAGGG + Intergenic
1119138696 14:72245058-72245080 CGTTTAGAATTGCTGGAACATGG - Intronic
1120755025 14:88234799-88234821 TTTTCAGCAGAGCTGGAAGAAGG + Intronic
1122224051 14:100262708-100262730 CTGTCAGAATTGCTTGAACCCGG - Intronic
1122569497 14:102685659-102685681 ATTTCAGAATAGCTAGAAGAGGG + Intronic
1123031303 14:105452860-105452882 CTTTCAGAATAGGAGAGACAGGG + Intronic
1125128257 15:36250618-36250640 CCTCCAGAGTAGCTGGGACACGG - Intergenic
1125507602 15:40276054-40276076 CTTTCGGTAGAGCTGGATCAGGG - Exonic
1125539608 15:40462378-40462400 CTCTCAGAGTAGCTAGAACCAGG - Intronic
1129107157 15:73318332-73318354 CTGTCTGAATTGCTGGTACATGG + Intergenic
1129284364 15:74512402-74512424 CTTTCACAATTGCTGCAGCAGGG - Intergenic
1130764396 15:86855481-86855503 CTTGCTGAATCACTGGAACATGG + Intronic
1131327792 15:91465739-91465761 GTGTGAGGATAGCTGGAACAGGG - Intergenic
1132023059 15:98381496-98381518 ATCTCAGAATATCTGGAACATGG + Intergenic
1132877533 16:2147035-2147057 CTTTCAGGATGGCTGGCCCAGGG - Intronic
1133467394 16:6040984-6041006 CTGTCATAATAGCTAAAACACGG - Intronic
1133904804 16:10012503-10012525 CTTTTAGAATCGATTGAACAAGG - Intronic
1135539433 16:23318674-23318696 CTTTCAGAGTGGCTGTAAGAAGG + Intronic
1136492617 16:30619426-30619448 CTTGCACAATAGCTGGAGCCTGG + Intronic
1137629158 16:49930083-49930105 CCTTCAGCACAGCTGGACCAAGG - Intergenic
1138771329 16:59667417-59667439 TTTTCAGAATTGAGGGAACATGG - Intergenic
1140379292 16:74471784-74471806 TTTTAAGAAGAGATGGAACAGGG - Intronic
1142128214 16:88420588-88420610 CTTTGAGAATTGCAGGATCATGG + Intergenic
1142496401 17:308516-308538 TGTTCACAATAGCTGCAACATGG + Intronic
1146578776 17:34017665-34017687 CTTTCTGAATATCAGCAACAAGG - Intronic
1149061757 17:52430902-52430924 TTCTCACAATACCTGGAACAAGG - Intergenic
1149349059 17:55769012-55769034 CTTTGAGGACAGCTGCAACAGGG + Intronic
1149401384 17:56299753-56299775 CTAGCACAATAGCTGGCACATGG + Intronic
1149844554 17:59998137-59998159 CTTTGACAATAGATGGAACCAGG - Intergenic
1150949263 17:69784045-69784067 ATTTCACAATAGCTAGAAGAGGG + Intergenic
1151013118 17:70524884-70524906 ATTGAAGAATAGCTGAAACAAGG + Intergenic
1153615774 18:6931630-6931652 CTTTCTGAATAGCTTCAATAAGG + Intergenic
1153863532 18:9238724-9238746 CTCTCAGTTTAGCTGGAAGATGG - Intronic
1155679190 18:28468720-28468742 CCTTCACAAGAGCTAGAACATGG - Intergenic
1156914032 18:42444387-42444409 CTTTCAGAATAGCTTAAATCTGG - Intergenic
1156997814 18:43489308-43489330 CCTCCCGAGTAGCTGGAACATGG - Intergenic
1157115233 18:44856282-44856304 CTGTCAGAAAAGGTGGAAAAGGG + Intronic
1157697697 18:49736306-49736328 CTCTCCAAGTAGCTGGAACATGG - Intergenic
1157902079 18:51528068-51528090 CTTTCTGATTAGCTAGCACAGGG + Intergenic
1158232366 18:55271774-55271796 CTTTCAGAATAGCTGTACTATGG - Intronic
1159212922 18:65350975-65350997 TTTTCACAATAGGAGGAACATGG + Intergenic
1161094728 19:2383680-2383702 CCTCCAGAGTAGCTGGAATATGG - Intergenic
1165782395 19:38442048-38442070 CTATGAGATTAGGTGGAACACGG + Intronic
1167114600 19:47481268-47481290 ATCTCAGAATTGCGGGAACATGG + Intronic
926413438 2:12627681-12627703 CTTCCAGAAAAGTTGGAAAAGGG - Intergenic
926844911 2:17125677-17125699 CTTTAGGTATAGCTGGAAGAAGG - Intergenic
929284645 2:40121541-40121563 CTTTTAGGGTAGCTGGAATAGGG - Intronic
930324135 2:49892614-49892636 CTCTCAGAAAAACAGGAACAAGG - Intergenic
931068110 2:58610831-58610853 CTTTCAGAATATTGGGAAAATGG + Intergenic
931675282 2:64688711-64688733 CTAACAGAATAATTGGAACATGG - Intronic
933039909 2:77451396-77451418 CTTTCTGATGAGCTGGAAAACGG + Intronic
935536581 2:104301244-104301266 CTTACAGAATACCTGAAACTGGG - Intergenic
935985447 2:108668217-108668239 ATTTCAAAATAGCTAGAAAAGGG - Intronic
936137876 2:109911864-109911886 ATTTCAAAATAGCTAGAAAAGGG - Intergenic
936206821 2:110459621-110459643 ATTTCAAAATAGCTAGAAAAGGG + Intronic
936416114 2:112313750-112313772 CATCCAGAATAGCATGAACATGG + Intronic
936693316 2:114918514-114918536 CTTTCACAGTAGCAGGGACATGG + Intronic
939620896 2:144417802-144417824 ATTTCAGAATAGCTAGAACGGGG + Intronic
941934475 2:170972361-170972383 GCTTCAGAAGAGATGGAACAAGG - Intergenic
943037836 2:182768278-182768300 TTTTCAGAATAGCTGAGAGATGG + Intronic
945802891 2:214455558-214455580 ATTTCAAAATAGCTGGAAGAGGG - Intronic
947075200 2:226335450-226335472 TTTTCAGAAGAGATGGATCATGG - Intergenic
948309927 2:236977438-236977460 GTTTCTGAATAGCTGGAGGAGGG + Intergenic
1170061541 20:12264661-12264683 CTTTAAGATTATCTGGAAAATGG + Intergenic
1171055451 20:21902402-21902424 ATTTCAGGATAGCTAGAAGAGGG - Intergenic
1171402715 20:24888632-24888654 CATTCACAATAGCTAAAACATGG + Intergenic
1172136426 20:32689715-32689737 CTTCCAGAATAGCTGAATCCTGG + Intergenic
1173705336 20:45106197-45106219 CTCACAGAACTGCTGGAACAGGG + Intergenic
1174934524 20:54853103-54853125 CTTTAAGACTATCTGGAATATGG - Intergenic
1177352050 21:19955908-19955930 ATTTCAAAATAGTTAGAACAGGG - Intergenic
1177760105 21:25393579-25393601 CTTCCAAAACAGCTGGAAGATGG + Intergenic
1177903431 21:26946097-26946119 GTTCCAGAGTAGCTGGAACCAGG + Intronic
1179287700 21:39992329-39992351 ATCTCAGAATAGGTGGAACTGGG - Intergenic
1182562116 22:31168488-31168510 TATTCACAATAGCTGAAACATGG - Intronic
951192116 3:19783205-19783227 TTTTAGGAATAGGTGGAACAAGG + Intergenic
953864634 3:46573628-46573650 CTCTCAGAACAGCTGGAAGCTGG + Intronic
954728103 3:52633435-52633457 CATTCACAATAGCTAAAACATGG - Intronic
956523851 3:70134902-70134924 CTCTAAGAAAAGCTGGAAAAAGG + Intergenic
957496372 3:80996242-80996264 CTTTCAGAAAACCTGCAACCTGG + Intergenic
958843617 3:99238937-99238959 ATTTCAAAATAGCTAGAAGAAGG - Intergenic
961188827 3:124940157-124940179 CATCCAGAACAGCTGGCACATGG + Intronic
961925803 3:130478939-130478961 CTTTCACAATAGTTGGGAAATGG - Intronic
961952874 3:130769112-130769134 CATTCACAATAGCTGGAATTTGG + Intergenic
963233968 3:142937503-142937525 CTTCAAGAATAGCTGGATCTAGG - Intergenic
963676003 3:148312545-148312567 CTTTATTAATAACTGGAACATGG - Intergenic
964180459 3:153877638-153877660 CTTTCCCATTAGCTGGAATATGG - Intergenic
965540635 3:169867869-169867891 CTTTAAAAATAGCTGAAATATGG + Intronic
965790343 3:172380640-172380662 CTTCCAGAATACCTAGGACAGGG + Intronic
967585058 3:191203248-191203270 CTTACAGAATGCCTGGCACAGGG - Intronic
968714407 4:2144513-2144535 TTTTCATAATAGCTGGCACGTGG - Intronic
968889575 4:3361255-3361277 CATAAAGAAGAGCTGGAACATGG + Intronic
969180117 4:5433936-5433958 CTTCCAGAAAAGCAGGAACATGG - Intronic
970664319 4:18319417-18319439 ATTTCAGCATAGCGGGGACAGGG - Intergenic
971083791 4:23246524-23246546 CTTTCACAATAGCTGAAACAGGG - Intergenic
972386462 4:38571150-38571172 CTCTTTGAATGGCTGGAACATGG + Intergenic
973576632 4:52296341-52296363 CTATCAGAATAAGGGGAACATGG + Intergenic
974385062 4:61193576-61193598 TTTTAATAATAGATGGAACATGG - Intergenic
974864353 4:67562218-67562240 CCTTCCGAATAGCTGGGACCGGG - Intronic
976392687 4:84522040-84522062 CTTCCAAAAAAGCTGGAAGAAGG - Intergenic
978103705 4:104875448-104875470 ATTCCAGAATCTCTGGAACATGG + Intergenic
979001961 4:115232685-115232707 CTTTCACACTAGCTGCAGCAAGG - Intergenic
979367772 4:119846245-119846267 TATTCACAATAGCTGAAACATGG + Intergenic
980888669 4:138790500-138790522 CTGTCTGAATTGCTGGAAAATGG + Intergenic
985059592 4:186063790-186063812 CCTTCACAATAGCTAAAACATGG + Intergenic
987290690 5:16505635-16505657 CCTTCAGGACAGCTGGAACAGGG + Intronic
987317470 5:16737324-16737346 CTTTCAGAGTGGCTGAAACTAGG + Intronic
988128747 5:27076269-27076291 TTATCAGAATATCTGGGACACGG + Intronic
989340874 5:40374255-40374277 CTTTCAGAATAGATTGGAGAAGG + Intergenic
990131370 5:52589811-52589833 ATTTCAAAATAGCTAGAAGATGG + Intergenic
992786697 5:80176845-80176867 CTTTAATCATAGCTGAAACAGGG - Intronic
993303992 5:86252201-86252223 GTTTCAGTAGATCTGGAACAGGG - Intergenic
997588705 5:135060033-135060055 CTTTCAGAACAGCAGCAGCAGGG + Intronic
997766570 5:136510340-136510362 TGTTCAGAATTGCTGGAACCTGG - Intergenic
999111549 5:149125733-149125755 CTGTGAGGAAAGCTGGAACATGG + Intergenic
1000257155 5:159550603-159550625 CTATCAGAATATCTGGCATATGG + Intergenic
1000454607 5:161434497-161434519 TTTTGAGAAAGGCTGGAACATGG - Intronic
1001850582 5:174961208-174961230 ATTTCAAAATAGCTAGAAGAGGG - Intergenic
1003455623 6:6279084-6279106 CTTTCCTAAAAGCTGGAACTGGG + Intronic
1003456535 6:6287858-6287880 CTGTCAGAATGGATGTAACAAGG + Intronic
1004566381 6:16801862-16801884 CTGTCAGAATGACTGGGACAGGG - Intergenic
1004819392 6:19350562-19350584 CTTTCATAATATGTGGAATACGG + Intergenic
1005687226 6:28266320-28266342 TTTTCACAATAGCAGAAACATGG - Intergenic
1005842805 6:29755267-29755289 CTTTGAGTATAAATGGAACAGGG - Intergenic
1006057654 6:31397315-31397337 CTTTGAGAATAAATGGAACAGGG + Intergenic
1006070136 6:31492315-31492337 CTTTGAGAATAAATGGAACAGGG + Intergenic
1006358270 6:33573338-33573360 CTTCCAGAATAGCTGAATCCTGG + Exonic
1007493950 6:42246160-42246182 CTGTCAGAATAACTAGAACTCGG - Intronic
1007679313 6:43623578-43623600 CTATCAGAAGAGCTGGAGAACGG - Intronic
1008453731 6:51684065-51684087 CTTTCAGAATAGCTGGAACATGG - Intronic
1008481691 6:51992874-51992896 CCTTCAGTATTGCTGGTACAAGG + Intronic
1010070777 6:71742065-71742087 CTTGCATGATAGCTGGAACAAGG + Intergenic
1010824986 6:80462319-80462341 CTTTCTCAATAGTTGGTACATGG + Intergenic
1010941678 6:81926449-81926471 TTTACAAAATACCTGGAACAGGG + Intergenic
1011028916 6:82899737-82899759 CTTTTAGAATAACTGGACTACGG + Intronic
1011472446 6:87721499-87721521 CTTTCCAAGTAGCTGGAACCAGG + Intergenic
1012041263 6:94206814-94206836 CTTTTGGAATATCTGGCACATGG + Intergenic
1012689420 6:102294119-102294141 CTTCCAGAAAAGTTGGAAAAGGG - Intergenic
1016511726 6:144850196-144850218 CTTTCAGCATACCTGGGAAAAGG + Intronic
1017444232 6:154492913-154492935 CTTTCAGAATACCCGGAACCTGG + Intronic
1017475828 6:154791454-154791476 CTATAAGAAGAGCTGTAACAAGG + Intronic
1017991244 6:159491656-159491678 CTGTCAGACTAGCTGGCACATGG + Intergenic
1018624299 6:165762969-165762991 CTTTCAAAAGCCCTGGAACAAGG + Intronic
1019087778 6:169497974-169497996 CATTCACAATAGCTAAAACATGG + Intronic
1020067545 7:5200647-5200669 AGTTCAGAATCGCTGGAACCTGG - Intronic
1020669326 7:11087095-11087117 CTTTCAGAATAGAATGAAAAGGG - Intronic
1020679892 7:11223398-11223420 ATTTCAGAATACTTGGAATAAGG + Intergenic
1021235833 7:18141652-18141674 CTTTCAGAATAGCGGGGACACGG + Intronic
1021337733 7:19424554-19424576 CTTTCAAAATATCTTGATCATGG + Intergenic
1021970658 7:25962647-25962669 CTTTCAGAATAAATGGAACCAGG + Intergenic
1021984505 7:26085696-26085718 CTTTCAGAATGCCTGGGACAGGG - Intergenic
1022295465 7:29047249-29047271 GTTTCAGAATGGTTGGAAAAGGG + Intronic
1022502076 7:30887923-30887945 CATTCCGAATGGCTGGAGCACGG + Intronic
1023927019 7:44676769-44676791 CATTCAGAATAACTGCAACCTGG - Intronic
1024524734 7:50338406-50338428 CTTTCAACACAGATGGAACAAGG - Intronic
1024616688 7:51120940-51120962 GATTCATAATAGCTGAAACATGG - Intronic
1026540200 7:71273443-71273465 CTTTCACAATAGCTATAACCAGG - Intronic
1028809062 7:95062841-95062863 CTTTCATAATAGAAGAAACATGG - Intronic
1029106676 7:98182803-98182825 CATTCACAATAGCTGAAATATGG + Intronic
1029714737 7:102319806-102319828 CTGTGGGAACAGCTGGAACAGGG - Intronic
1030377424 7:108769916-108769938 CTATCAGAATAACTGGAATGGGG + Intergenic
1031263980 7:119560055-119560077 ATTTTAATATAGCTGGAACATGG + Intergenic
1031281151 7:119801066-119801088 CTTTCAGAATCCCTGTAGCATGG - Intergenic
1031773942 7:125883317-125883339 TTTTCAGAGTTGCTGGAAAAGGG - Intergenic
1033665603 7:143437799-143437821 CTTTCAGAATCACTGGCACTGGG + Intergenic
1033948207 7:146749027-146749049 CTTTCATAATACCTGACACATGG - Intronic
1036427398 8:8657623-8657645 CTTTTTGAATATCTGGAATATGG - Intergenic
1037045186 8:14291273-14291295 ATTTCAAAATAGCTAGAAGAGGG + Intronic
1038809316 8:30823818-30823840 ATTTAAAAATAGCTGGAAGAGGG - Intergenic
1039755738 8:40519927-40519949 GTTTCAAAATAGCTAGAAGAGGG - Intergenic
1043136888 8:76539089-76539111 CTTTATGAATGGCTGGATCAAGG + Intergenic
1044762694 8:95538365-95538387 CATTCAGAATATCTGAAGCAGGG + Intergenic
1045883345 8:107066272-107066294 TTTTCACAATAGCAGAAACATGG + Intergenic
1045947029 8:107807994-107808016 CTTTCATAAAAGCTGAAACAAGG + Intergenic
1046109220 8:109701802-109701824 CTTTCAGAATACATTGCACATGG - Intergenic
1047537820 8:125735325-125735347 CTTTCAGCACAGAGGGAACACGG - Intergenic
1048510244 8:135055450-135055472 CTTTCAGAATAGGGTGAAAAAGG - Intergenic
1050025053 9:1325273-1325295 GTATCAGAATGGCTGGAAAAGGG + Intergenic
1050216460 9:3330857-3330879 GTTTTAGAAAAGCTGGAACCTGG + Intronic
1051151565 9:14085322-14085344 CTTTCAGAATTGGTGACACATGG - Intronic
1051606320 9:18920783-18920805 CTTTAGGCATAGCTGGAACCAGG - Intergenic
1052123496 9:24747837-24747859 CTTTTTGAATAGCTGAACCAGGG - Intergenic
1052545958 9:29880107-29880129 ATTTTATAATAGCTGAAACAAGG - Intergenic
1053136240 9:35651821-35651843 TTTTCAGAATTTCTGGAACATGG - Intergenic
1055334772 9:75222561-75222583 ATTTCAGAATACCAGGAATAAGG - Intergenic
1056752446 9:89362413-89362435 CTTTCAGGAAAGCTGTAGCAAGG - Intronic
1060004378 9:119986606-119986628 CTCTCAGAATAACAGGATCAGGG + Intergenic
1188996411 X:36891619-36891641 TTTTCAGAATAGTTTGAATAGGG - Intergenic
1193596129 X:83447716-83447738 GTTTTAGAATAGTTAGAACAGGG + Intergenic
1194068168 X:89287375-89287397 CATTCAGAATAGATTGAAAATGG + Intergenic
1195540893 X:106061435-106061457 TGTTCACAATAGCTGAAACATGG - Intergenic
1196485778 X:116204990-116205012 CTCTCAAAAAAGCTGGAACTCGG - Intergenic
1198571076 X:137957829-137957851 ATTTCTGGATAGCTGTAACAGGG + Intergenic
1199528223 X:148816525-148816547 TTTTCAGAATAAGTGGAACATGG + Intronic
1200409618 Y:2848363-2848385 GTTTCAGAAAAGATGGAACCTGG + Intronic
1200722311 Y:6621545-6621567 CATTTAGAATAGATTGAACATGG + Intergenic
1201373804 Y:13294677-13294699 CTTTCTGCATAACTGAAACATGG - Intronic
1201708931 Y:16967922-16967944 CTATCAGAGTGGTTGGAACAAGG + Intergenic
1202049334 Y:20764393-20764415 GTTTCAGAAAAGATGGAACCTGG + Intronic