ID: 1008460089

View in Genome Browser
Species Human (GRCh38)
Location 6:51758539-51758561
Sequence TCCTAGATCTTCAGGGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 217}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008460083_1008460089 20 Left 1008460083 6:51758496-51758518 CCCAGCTGTATTCTCTGTATTTT 0: 1
1: 1
2: 8
3: 157
4: 1580
Right 1008460089 6:51758539-51758561 TCCTAGATCTTCAGGGAAGAGGG 0: 1
1: 0
2: 0
3: 21
4: 217
1008460085_1008460089 -6 Left 1008460085 6:51758522-51758544 CCTCTGATTAGTATGACTCCTAG 0: 1
1: 0
2: 0
3: 6
4: 63
Right 1008460089 6:51758539-51758561 TCCTAGATCTTCAGGGAAGAGGG 0: 1
1: 0
2: 0
3: 21
4: 217
1008460084_1008460089 19 Left 1008460084 6:51758497-51758519 CCAGCTGTATTCTCTGTATTTTA 0: 1
1: 0
2: 3
3: 57
4: 526
Right 1008460089 6:51758539-51758561 TCCTAGATCTTCAGGGAAGAGGG 0: 1
1: 0
2: 0
3: 21
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008460089 Original CRISPR TCCTAGATCTTCAGGGAAGA GGG Intronic
901741410 1:11344314-11344336 TCCTAGAAAGTCAGGGAAGCAGG + Intergenic
901840283 1:11949977-11949999 TCCCAGAACATCGGGGAAGAAGG + Intronic
905413462 1:37788415-37788437 TCCTAGTTCTGTAAGGAAGAAGG + Intergenic
905608734 1:39329453-39329475 TCCTAGACCTTCATGGACAATGG + Intronic
907009544 1:50950770-50950792 TAGTAGATCTTCAGGAAGGAAGG - Intronic
907182339 1:52581858-52581880 TTCAAGCTCTTGAGGGAAGATGG - Intergenic
908518299 1:64915906-64915928 TTCTGGAGCTGCAGGGAAGAGGG - Intronic
909032620 1:70560383-70560405 GCCCAGATCTTCAGGAATGAAGG - Intergenic
909468657 1:76002220-76002242 TCCTAGGCCTTTATGGAAGAGGG - Intergenic
909735123 1:78949528-78949550 TCCACAATCTTGAGGGAAGAGGG - Intronic
913440925 1:118896790-118896812 TCTTAGTTCTTAAGGGAAGAGGG + Intronic
914247529 1:145897164-145897186 TCCTGGGACTTCAGGGAAGGGGG - Intronic
914757655 1:150573650-150573672 GCCTTGATCTTGAGGTAAGAGGG - Intergenic
915490152 1:156246234-156246256 CCCTAGGTGTTCTGGGAAGATGG - Exonic
915900435 1:159842866-159842888 TCCTTAATTATCAGGGAAGAGGG + Intronic
917724537 1:177816219-177816241 TCCTAGAGCTGCAGTGAAGATGG + Intergenic
918610407 1:186483867-186483889 TCCTAGTTCCACATGGAAGAAGG - Intergenic
919418259 1:197338532-197338554 TCCATGATATTCTGGGAAGATGG + Intronic
922236060 1:223723599-223723621 TCTTAGATCTTAAGTGCAGAGGG - Intronic
924108735 1:240676169-240676191 TCCTATATTTTGAGGGAAGGTGG - Intergenic
1063650872 10:7935654-7935676 TTTTAGATATTCAGGGAAGGGGG + Intronic
1063863913 10:10343308-10343330 TCCAATATCTGCAGTGAAGAGGG + Intergenic
1064393303 10:14959716-14959738 TCCGTGATTTTTAGGGAAGAGGG + Intronic
1065225584 10:23540497-23540519 GCCAAAATCTTCAGAGAAGAAGG - Intergenic
1065395571 10:25233210-25233232 TTATAGCTCTTCAGGAAAGAGGG + Intronic
1066498050 10:35961606-35961628 TCCCAGATCTCCTGGGAAGGAGG + Intergenic
1067340773 10:45401654-45401676 TCCTAAATGTCCAGGGAAGCTGG - Intronic
1067735199 10:48845189-48845211 TCCAAGTTCTTCAGGGAATTGGG + Intronic
1072111943 10:92330504-92330526 TCCTGGATCTTTAAGGAAAAGGG + Intronic
1072533728 10:96343794-96343816 TCTTGGTTATTCAGGGAAGAGGG + Exonic
1072551948 10:96485828-96485850 TGCCAAATCTTCAGGGAAGTGGG - Intronic
1073567996 10:104551940-104551962 ACCTTGATGTTCAGGGCAGAGGG + Intergenic
1076199764 10:128548753-128548775 TCCTAGATGTTCAGGGCATCAGG + Intergenic
1078175565 11:8967242-8967264 TCCTAGACCTTCAGGTCACACGG + Intergenic
1079433713 11:20423184-20423206 TCCTAGATGGTCTGGGAAAAAGG - Intronic
1081181490 11:39990662-39990684 TCCTAGATTTTCAGGAAAACCGG - Intergenic
1081569168 11:44278892-44278914 TCCTGGTTCCTCAAGGAAGAAGG + Intronic
1082794793 11:57371142-57371164 TCCTGGCCCTTCAGGGAAGGAGG + Intergenic
1083304238 11:61754438-61754460 TTTGAGACCTTCAGGGAAGAGGG + Intronic
1086119694 11:83293290-83293312 CCCCAGATTTTCAGGGAATACGG - Intergenic
1086348012 11:85917416-85917438 TCCTACATCTTGATGGAGGAAGG + Intronic
1087197321 11:95314550-95314572 TCCTCAATCTTCAGGAAAGGTGG + Intergenic
1087291502 11:96325777-96325799 TCCGACATTTCCAGGGAAGAAGG - Intronic
1087699076 11:101414783-101414805 TCATAGAGCTTCAGGTAAAAAGG - Intergenic
1088130875 11:106489015-106489037 GCCTTGATCTTAAGGGGAGAGGG - Intergenic
1088781053 11:113134666-113134688 TCCTACAAATTCAGGGCAGAAGG + Intronic
1088889004 11:114030203-114030225 TCCTAGCTCTTGAGGAAGGAGGG + Intergenic
1088964504 11:114704455-114704477 TCATAGAACTTCAAGTAAGATGG - Intronic
1088995720 11:114994797-114994819 CCCAAGATCTTCAGGGAGTAGGG + Intergenic
1089436867 11:118476227-118476249 TCCTTGATCATCAGAGAAGTAGG - Intronic
1090652357 11:128818711-128818733 TCATAGACCGTCAGGGAAGTAGG + Intergenic
1090761537 11:129841094-129841116 TACTAGATCTTCAGGCAAGTAGG + Intronic
1091478866 12:806164-806186 TCTTAGCTATTCAGGAAAGATGG + Intronic
1091487547 12:904439-904461 TCTTTGTGCTTCAGGGAAGATGG + Intronic
1092829392 12:12429243-12429265 TCCTGGATCTTCTGAAAAGAGGG - Intronic
1093865764 12:24225781-24225803 TCTTATATATTCTGGGAAGAGGG - Intergenic
1094325518 12:29233793-29233815 GCCTAGCTCTGGAGGGAAGAAGG - Intronic
1094410961 12:30168670-30168692 TCTTAGATATTTAGAGAAGATGG - Intergenic
1094473907 12:30826797-30826819 TCCTAGATCTCCAGGGACCCAGG - Intergenic
1095227246 12:39692043-39692065 TCCTAGATTCTGATGGAAGAAGG + Exonic
1098421840 12:70305833-70305855 ACCAAGAACTTCAGAGAAGACGG - Intronic
1101625072 12:106432507-106432529 TCCTAGATAGTCTGTGAAGAGGG + Intronic
1101749558 12:107572285-107572307 TCCTAGATCTCCATGAGAGAGGG + Intronic
1102619054 12:114179185-114179207 TCATAAATCTTCATGGAAGGTGG - Intergenic
1104388072 12:128368103-128368125 GGCTAGATCTTCCTGGAAGATGG - Intronic
1104797247 12:131528297-131528319 GAGTAGAACTTCAGGGAAGAGGG + Intergenic
1104801216 12:131556268-131556290 TCCTATATCCTCAGGGATGCTGG - Intergenic
1105048917 12:133030218-133030240 TCCTCAATCTTGAGGGAAGTGGG + Intergenic
1107937664 13:45358619-45358641 TCCCATATATTCTGGGAAGAGGG - Intergenic
1107948995 13:45445247-45445269 TCCCACATCTTAAAGGAAGAAGG - Intergenic
1115876171 14:37864467-37864489 TCCTAGGAAGTCAGGGAAGAGGG + Intronic
1116136865 14:40936098-40936120 TCCAACATCTTTAGGGAATACGG - Intergenic
1116881763 14:50177477-50177499 TCCTAGATATTCAGTGAAATTGG - Intronic
1119689401 14:76659295-76659317 TTCCAGATTTTCAGGGAAGGAGG + Intergenic
1119745321 14:77039860-77039882 TCTAAGATCTGTAGGGAAGAGGG - Intergenic
1121114968 14:91337088-91337110 TCCTAAATCCTCAGAAAAGAGGG + Intronic
1121466060 14:94116200-94116222 GCCTCGCTCTTCAGGGAAGGAGG - Intronic
1122034755 14:98939222-98939244 GCCTTGATCTTCTGGGAAGATGG - Intergenic
1122647152 14:103202533-103202555 TCCTTGACCTCCAGGGAACAAGG + Intergenic
1124687658 15:31796306-31796328 TCCAAAATCTGCAGGGCAGATGG + Intronic
1125485301 15:40107455-40107477 TCCTCATTCTCCAGGGAAGAGGG - Intronic
1130809136 15:87358464-87358486 TTCTAGATCTCCATGGATGAGGG - Intergenic
1133177434 16:4025782-4025804 TCCCAGACTTTCAGGGAAGGGGG + Intronic
1133227064 16:4346116-4346138 GCCTAGAGCTGCAGGGCAGAGGG + Intronic
1133450095 16:5896717-5896739 GCATAGCTCTTCAGGGGAGAGGG + Intergenic
1133691085 16:8216020-8216042 TCCTAGTTCTTCAGGGAGGGTGG - Intergenic
1134189732 16:12111870-12111892 TCTCAGATCTTCAGAGAAGCAGG - Intronic
1138378750 16:56585531-56585553 TCCTAGAGCTTCCTGGCAGAAGG - Intergenic
1138511362 16:57510292-57510314 TCCTAGCTCTTCAGGGTCAAAGG + Intergenic
1139204364 16:65012870-65012892 TCTTAGAAATTCAGAGAAGAAGG - Intronic
1142184654 16:88688766-88688788 TCCTAGATGTCCAGGGAAGGGGG - Intergenic
1142424999 16:89997466-89997488 TCCATTACCTTCAGGGAAGAAGG - Intergenic
1142554240 17:762437-762459 TGCGTGATCTTCAGGGATGAAGG + Intronic
1142554255 17:762505-762527 TGCGTGATCTTCAGGGATGAAGG + Intronic
1142554270 17:762573-762595 TGCGTGATCTTCAGGGATGAAGG + Intronic
1142554297 17:762712-762734 TGCGTGATCTTCAGGGATGAAGG + Intronic
1145085576 17:19936344-19936366 TCCAATATCTGCAGGGAAGGTGG - Exonic
1146547801 17:33754238-33754260 TCCTAAAACATCAGGGATGATGG + Intronic
1147418503 17:40310276-40310298 CCCTAGATCTTCAGAGAGCAGGG - Intronic
1148898280 17:50853809-50853831 TCCCAGATTTTCAAGGAGGATGG - Intergenic
1149028087 17:52053172-52053194 TCCTATATCTTGAAGGAAGATGG + Intronic
1151295267 17:73181055-73181077 TCCTACATGCTCAGGAAAGAGGG + Intergenic
1153027583 18:685594-685616 TCCTAGCTCCTCAGGTAGGAGGG - Intronic
1154293587 18:13131201-13131223 TGCCAGGTCCTCAGGGAAGATGG + Intergenic
1158978380 18:62734312-62734334 CTCTGGATCTTCATGGAAGAAGG + Intronic
1159511119 18:69400230-69400252 TCCTGGCTCTTCTGGGAAAATGG - Intergenic
1159908212 18:74117873-74117895 GTCTAGAACTTCAGAGAAGAGGG - Intronic
1161439579 19:4283048-4283070 TCCTAGAACTTCCCGGCAGAGGG + Exonic
1163123692 19:15232933-15232955 TCCTGGATCTTCAGTTAAGTGGG + Intronic
1163618157 19:18341555-18341577 TCCAGGAGATTCAGGGAAGAAGG + Intronic
1164311037 19:24046703-24046725 TCATAGCTCTTCAGTGTAGAGGG + Intronic
1166546064 19:43635521-43635543 TCCTAGGTCTTGAGGGAGGAAGG - Intronic
1166587629 19:43964830-43964852 TCCTAGATCTTGAGGGATGTAGG - Intronic
1166787866 19:45380029-45380051 TCCTGGAAGTCCAGGGAAGAAGG - Exonic
925497984 2:4473421-4473443 TCATATATCTTAAGGGAAAAAGG + Intergenic
928372922 2:30754205-30754227 TCGTAAATGTTCAGGGAAAAGGG + Intronic
928891846 2:36213342-36213364 TCCTAGATCATCTGGAAACATGG - Intergenic
928917594 2:36489766-36489788 TGCTAGATCTTTAGGGACAAGGG - Intronic
929449907 2:42029980-42030002 TCCTTTATCTTAAGAGAAGAAGG + Intergenic
933920488 2:87040625-87040647 TCTTAGAGCTTCAGAGAAGCAGG + Intergenic
933931136 2:87153161-87153183 TCTTAGAGCTTCAGAGAAGCAGG - Intergenic
934002509 2:87729273-87729295 TCTTAGAGCTTCAGAGAAGCAGG - Intergenic
935551886 2:104466588-104466610 TGCAAGATCTTCAGTGAAGTTGG - Intergenic
936361986 2:111812271-111812293 TCTTAGAGCTTCAGAGAAGCAGG + Intronic
937161258 2:119764009-119764031 TCACAGAACTTCAGGCAAGAAGG - Intronic
937187428 2:120057541-120057563 ACCTATAGCTTAAGGGAAGATGG + Intronic
937535334 2:122879629-122879651 TTCTAAATCTTCAGGAAATATGG - Intergenic
939040542 2:137184162-137184184 TCCTGCATCTTCAGGAGAGAAGG + Intronic
939755036 2:146099859-146099881 TCCTAGCTCTTCAAGGATGCTGG - Intergenic
941455727 2:165710790-165710812 TCCTCAATCTTCAGGAAAGGTGG - Intergenic
941547976 2:166877690-166877712 TTCTAGACCTCCAAGGAAGAAGG + Intergenic
943024140 2:182608203-182608225 TTTTAGATTTTCAGGGAAAAGGG - Intergenic
943536853 2:189162881-189162903 TCCTTTATCTTCTGGGAAAATGG - Intronic
944310995 2:198233769-198233791 TCCTACATTTTCATGGAAAAGGG + Intronic
945578627 2:211564356-211564378 TCCTAGAGGTAAAGGGAAGAAGG - Intronic
947987545 2:234462146-234462168 TCCTGAGCCTTCAGGGAAGAGGG + Intergenic
948122827 2:235543698-235543720 TCCTAGGCCTGCAGGGAAGAAGG - Intronic
948854737 2:240724901-240724923 TCCGTGGTCCTCAGGGAAGAAGG + Intronic
1169479388 20:5964346-5964368 TCTTAATTTTTCAGGGAAGAAGG - Intronic
1170412237 20:16104263-16104285 TCCTTGTTCTTCAGGGTAGGAGG - Intergenic
1170894935 20:20404339-20404361 TCCTATATCTTCCTGGAAAAGGG + Intronic
1171174236 20:23039338-23039360 TCCCAGATGGTCAGGGAAGATGG + Intergenic
1171182346 20:23100051-23100073 TTCTAGATCTTCAGGCATGCTGG - Intergenic
1172898478 20:38316938-38316960 TCCCACATCTTCAGTGAAGGAGG + Intronic
1173605357 20:44327317-44327339 GCCTAGCCCTTCAGGGAAGGGGG - Intergenic
1173652515 20:44675787-44675809 TCCTCAATCTTCAGGAAAGATGG + Intergenic
1174078859 20:47957057-47957079 TGCTCGATCTTCAGGCAAGCTGG + Intergenic
1182718847 22:32381380-32381402 TACTAGAGCTTGGGGGAAGAAGG + Intronic
1183231576 22:36585377-36585399 ACCTAGATCTTGAGAGAAGCTGG - Intronic
1183953633 22:41366747-41366769 TCTTTGGTCTTCAGGGGAGAGGG - Intergenic
1185371542 22:50463135-50463157 TCCTCGGTCTGCAGGGAACAGGG - Intronic
950895990 3:16451236-16451258 TCCTAGAAGTCAAGGGAAGACGG + Intronic
951218805 3:20048245-20048267 TCAGAAATTTTCAGGGAAGATGG + Intronic
954543678 3:51414850-51414872 TCATAAATCTTTAGAGAAGAAGG + Exonic
954957401 3:54533725-54533747 TCTAAGGTCTTTAGGGAAGAAGG + Intronic
956835082 3:73089982-73090004 TCCTAGAGCTTCCGTGGAGAAGG - Intergenic
957104631 3:75870707-75870729 TCCAAGATATTCAGTCAAGAGGG + Intergenic
957243665 3:77691147-77691169 TCTTACTTCTTCAGGGAAGTTGG - Intergenic
958443041 3:94179626-94179648 TCTTATATCTGCAGGGAAGTCGG + Intergenic
960372576 3:116859361-116859383 TCCTAGTGATTCAGGGAAGAAGG - Intronic
960485227 3:118244210-118244232 TCCTAGAGCTCCCTGGAAGATGG - Intergenic
961533987 3:127558131-127558153 TCCCACATTTACAGGGAAGAAGG + Intergenic
962090837 3:132242573-132242595 TCCAGGAACTTCAGGGAAAAAGG + Intronic
964646891 3:158968253-158968275 TCATAGATATTTAGGGAAGAAGG - Intronic
966878562 3:184336978-184337000 TCCTGGACCTTCAGGGCAGGTGG + Intronic
967851803 3:194088141-194088163 CCCTAGCTCCTCAGAGAAGAGGG - Intergenic
969869070 4:10093575-10093597 TCCTTGTTCTCCAGGGAACATGG - Intronic
970511582 4:16786973-16786995 CCCTAAAACTTCAGGGGAGATGG - Intronic
970833388 4:20369833-20369855 TCAAAGACCTTCAGGCAAGAGGG - Intronic
971297880 4:25415451-25415473 TCACAGATCTTCAAGAAAGAAGG - Exonic
971415854 4:26428483-26428505 TTTTAGATGTTCAGGGAAGAGGG + Intronic
972049827 4:34715555-34715577 TCTTAGATCTTGAGGAAAGCCGG - Intergenic
974583456 4:63837099-63837121 ACACAGGTCTTCAGGGAAGAAGG + Intergenic
974727759 4:65817818-65817840 TCCTCGATCCTCAGGGAACGAGG + Intergenic
975178844 4:71320009-71320031 TCCTATATCCTCAGAGAAAATGG - Intronic
975490617 4:74984401-74984423 TCCTCCACCTTCAGGGCAGATGG - Intronic
977091026 4:92676019-92676041 TCCTAATTATTCATGGAAGAGGG + Intronic
979503046 4:121461649-121461671 TCCTAGTTATTTGGGGAAGAAGG - Intergenic
981263870 4:142757441-142757463 GCCAAGAGTTTCAGGGAAGAAGG - Intronic
981927678 4:150157409-150157431 TCCCAGATACTCAGAGAAGAGGG - Intronic
987587714 5:19877815-19877837 TCCCAGATCTTAAGTGAAGTAGG - Intronic
990205421 5:53424000-53424022 TCATAGCTCCTCAGGGAGGAGGG - Intergenic
990610790 5:57454816-57454838 TCCTATACCTACAGGGAAAACGG + Intergenic
994976898 5:106819327-106819349 TCTTAGGTCTTCTGGGAAGCTGG + Intergenic
995121828 5:108544464-108544486 CCCTAGATCTTCAGGGGGCAGGG - Intergenic
996650089 5:125865309-125865331 TCTTAAACCTTCAGGGAATAAGG + Intergenic
997033950 5:130164595-130164617 TTCTAGATTTTCAGAAAAGATGG - Intronic
999735849 5:154512292-154512314 CCCTATAGATTCAGGGAAGAGGG + Intergenic
999842153 5:155439459-155439481 TTCTAGATCTTCAGTCTAGATGG + Intergenic
1000296964 5:159920589-159920611 TGTTAGGTTTTCAGGGAAGAAGG - Intronic
1001580308 5:172793744-172793766 TGCTTGAGCTTCAGGGAGGAAGG - Intergenic
1001702977 5:173720958-173720980 TCCTCCATCTCCAGGGAAGCAGG - Intergenic
1003203830 6:3989388-3989410 ACCTAGTTCTTAAAGGAAGAAGG - Intergenic
1003704369 6:8507863-8507885 TCCAAGCTCTGCAGGTAAGATGG - Intergenic
1004042346 6:11993123-11993145 TCTTAGATCTTCTGCTAAGATGG - Intergenic
1005967551 6:30737933-30737955 TGCTAGGTGTTCAGGAAAGAAGG - Intronic
1006084703 6:31587626-31587648 ACATATATCTTCAGGGAAGAGGG - Exonic
1006581258 6:35079063-35079085 TCCTGGCTCCCCAGGGAAGACGG - Intronic
1008460089 6:51758539-51758561 TCCTAGATCTTCAGGGAAGAGGG + Intronic
1008940115 6:57037769-57037791 TCATAGAGATACAGGGAAGAGGG - Intergenic
1012632479 6:101489156-101489178 TCATAAATATTTAGGGAAGAGGG + Intronic
1013159745 6:107531122-107531144 TCCTAGATCTTCAGCTATAATGG - Intronic
1016430884 6:143984011-143984033 TCCTGAATCTTCAAGGAATAAGG + Intronic
1020098143 7:5379844-5379866 TCCCAGGGCTTCCGGGAAGAGGG + Intronic
1021573095 7:22084536-22084558 TCATCGGTCTTCAGGGAAGCAGG + Intergenic
1026382244 7:69811445-69811467 TCCAAAATCTTCAGTCAAGAAGG + Intronic
1030279660 7:107758991-107759013 TCCTTGATCTTCAGTGAACTGGG - Exonic
1032197307 7:129796749-129796771 TCCTGGGTCATCAGGGAAGAGGG - Intergenic
1033234003 7:139623911-139623933 TCCTACGTCTGCAGGGAAAAGGG - Intronic
1033367983 7:140685687-140685709 GCCTGGATTTACAGGGAAGAGGG + Intronic
1034265602 7:149779247-149779269 TCCCAGATCCTCAGGGCAGAGGG + Intergenic
1035887666 8:3309170-3309192 ACCTAGACCTCCAAGGAAGAGGG + Intronic
1039329156 8:36517601-36517623 TCCTAGATATTGAAGGGAGAAGG + Intergenic
1041390680 8:57344702-57344724 TGTTAGAATTTCAGGGAAGATGG + Intergenic
1042824603 8:72967456-72967478 TCCCAGATCTTCTGGGACAATGG - Intergenic
1045645119 8:104290418-104290440 TCCTCAATCTTCAGGAAAGGTGG + Intergenic
1045773810 8:105777503-105777525 TCCTAGAACTTCTTGGGAGAAGG - Intronic
1047214286 8:122864173-122864195 TTCTAGATCACCAGGGAACAGGG - Intronic
1047350652 8:124070452-124070474 TCATATATCTTTAGGGAAAAGGG - Exonic
1051966671 9:22836349-22836371 TGCTGGTTCTTCAGGGAAAAAGG + Intergenic
1052899121 9:33775197-33775219 TACTAGATCTTTAGGCAAGTAGG + Intronic
1055437876 9:76310635-76310657 ACCTAGAAATTCAGGGAAGAGGG - Exonic
1056411926 9:86337425-86337447 TCCTAGATATACAGGCAAAAGGG + Exonic
1057171153 9:92963975-92963997 GTGTAGATCTTCAGGGAGGAGGG - Intronic
1057873106 9:98732861-98732883 TTCTAGATCGTCAGGGAGGAAGG - Exonic
1057873307 9:98734029-98734051 TTATAGATCGTCAGGGAGGAGGG - Exonic
1186944456 X:14549960-14549982 TCATTGATATTAAGGGAAGAGGG + Intronic
1187428625 X:19201813-19201835 TCCTAGATGCACAGGCAAGAAGG - Intergenic
1188367152 X:29330678-29330700 GCCTAGATCTTCAGAAGAGAAGG - Intronic
1189830794 X:44971219-44971241 TCCTAGTTCTTCATGCATGAGGG - Intronic
1190692921 X:52926851-52926873 TCCTAGATCTGCCCGGATGATGG + Intronic
1191954993 X:66634604-66634626 TCTTAGATCATCAGGGAATGGGG - Intronic
1195041554 X:101019495-101019517 TGCTAGATCCAAAGGGAAGATGG - Intronic
1196797729 X:119515645-119515667 TCCTAGAAATGAAGGGAAGAGGG + Intergenic
1197627581 X:128819917-128819939 TTCTAGAAGTTCAGGGAAGGTGG + Intergenic
1198939790 X:141941020-141941042 TGGTAGCTCTTCAGGGAAGAGGG + Intergenic
1202232215 Y:22669306-22669328 TCCTGAGTCTCCAGGGAAGATGG - Intergenic
1202310941 Y:23526852-23526874 TCCTGAGTCTCCAGGGAAGATGG + Intergenic
1202559861 Y:26143742-26143764 TCCTGAGTCTCCAGGGAAGATGG - Intergenic