ID: 1008463118

View in Genome Browser
Species Human (GRCh38)
Location 6:51799004-51799026
Sequence TTGGTACATTTGGAGTTGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 134}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008463118_1008463124 27 Left 1008463118 6:51799004-51799026 CCTACCAACTCCAAATGTACCAA 0: 1
1: 0
2: 0
3: 5
4: 134
Right 1008463124 6:51799054-51799076 TATTATAACCACTTGAGAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008463118 Original CRISPR TTGGTACATTTGGAGTTGGT AGG (reversed) Intronic
906168215 1:43703714-43703736 CTGGTACATTTGGATAGGGTGGG - Exonic
907263871 1:53242629-53242651 ATGGTAACTTTGGGGTTGGTAGG + Intergenic
907793002 1:57686016-57686038 TTGCTAGCTTTGGGGTTGGTTGG - Intronic
910761560 1:90737627-90737649 TTGACACATTTGGAGAAGGTGGG + Intergenic
911334870 1:96570956-96570978 TGGGTACATTTGGCCTTTGTTGG - Intergenic
911756114 1:101558762-101558784 TTAGTACAAATGGAGGTGGTTGG - Intergenic
912500972 1:110121677-110121699 GGGGTGCATTTGGAGATGGTTGG - Intergenic
917407200 1:174719823-174719845 TTGGGATTTTTGGAGGTGGTAGG + Intronic
917626527 1:176851909-176851931 TTTGTGCATTTGGGGTTGATGGG + Intergenic
921148869 1:212384475-212384497 TGGGCACAATTGCAGTTGGTGGG - Intronic
921869858 1:220128232-220128254 TTGGTACATATGGGGGTGGGGGG + Intronic
923654287 1:235901757-235901779 TTGGGCAATTGGGAGTTGGTTGG + Intergenic
1063687825 10:8255456-8255478 TTTGTACAATTTGAGTGGGTGGG - Intergenic
1064830110 10:19454218-19454240 TTTGTACTTTTGGATTTTGTAGG - Intronic
1070735878 10:78863346-78863368 TGGGTACATGTTGAGTTCGTGGG - Intergenic
1071342106 10:84658793-84658815 TTGGTACGTTGGGGGTTGGAGGG + Intergenic
1074894660 10:117764684-117764706 TTAGTATCTTTGGACTTGGTTGG + Intergenic
1074939107 10:118217408-118217430 TTTGTACACTTGGAGATGGGTGG - Intergenic
1075220276 10:120578657-120578679 TTTGTATATTTGGAGTGGGCTGG - Intronic
1075677990 10:124309417-124309439 GATGAACATTTGGAGTTGGTGGG - Intergenic
1079976190 11:27094357-27094379 TTGTAACCTTTGGAGTTGGAAGG - Intronic
1083019288 11:59489984-59490006 TAGGTCCATTTGTAGGTGGTTGG - Intergenic
1084141260 11:67231559-67231581 TTGGTAGATTTGGAGTTAAATGG + Exonic
1088815114 11:113415383-113415405 TGGGGACCCTTGGAGTTGGTTGG + Intronic
1088935245 11:114393001-114393023 TTAGTACATTTAGAAATGGTTGG + Intronic
1091783487 12:3228675-3228697 TTGGTACAGTTGATGTTGCTGGG + Intronic
1095904171 12:47360444-47360466 TTGGTAGATTTGGTGCTGGAAGG + Intergenic
1096657506 12:53100855-53100877 ATGGTGCGTTTGGAGCTGGTAGG + Exonic
1098241019 12:68467114-68467136 TTGTTAGATTTGGAGTTGCATGG - Intergenic
1100787828 12:98097166-98097188 TTGGTACTTTTCTAGGTGGTAGG + Intergenic
1101638723 12:106569455-106569477 TTATTTCATTTGGAATTGGTAGG - Intronic
1104313967 12:127679896-127679918 TTGGTACAATTGGTGTTTGGAGG - Intergenic
1106132421 13:26951425-26951447 TTTGAACATTTGCAGTTGGCTGG - Intergenic
1107863986 13:44685927-44685949 TTGGTCCATTTTGTGTTGCTAGG + Intergenic
1112609937 13:100946193-100946215 TTGGTAGATTTGGGGGTGGCTGG - Intergenic
1115959591 14:38820307-38820329 TTGCTAGCTGTGGAGTTGGTGGG - Intergenic
1119589119 14:75868478-75868500 TTGGTAAACTTGGACATGGTGGG - Intronic
1121360818 14:93257381-93257403 TCAGAACATTTGGATTTGGTTGG - Intronic
1124096194 15:26650816-26650838 TTGGTAGATGGGGAGATGGTTGG + Intronic
1126464114 15:48944916-48944938 TTAGGACATTTGAAGTTGTTAGG - Intronic
1139075124 16:63436779-63436801 TTGGTGCATTGGGAGGTGGGAGG + Intergenic
1147613427 17:41814256-41814278 TTGGGACTCTTGGAGTTTGTAGG - Intronic
1148953321 17:51333597-51333619 TGGGTTCTTTGGGAGTTGGTGGG - Intergenic
1150802946 17:68296079-68296101 TTCTGAGATTTGGAGTTGGTTGG - Intronic
1153667417 18:7378756-7378778 TTGTTACCTTGGGAGTTGGGAGG + Intergenic
1156436736 18:37138877-37138899 TTGATAATTTTGGAGTTGGAAGG + Intronic
1158034244 18:53005351-53005373 TAGGAAAATTTGGAGATGGTTGG - Intronic
1163765856 19:19162888-19162910 TGGGTACATGGGGAGTTTGTGGG - Intronic
1166362489 19:42259561-42259583 TTGTTACAGTTGGAGTCTGTAGG - Intergenic
1167296317 19:48652267-48652289 TTGGTACAATGAGATTTGGTAGG - Intergenic
926446234 2:12946246-12946268 TTGCTGCTGTTGGAGTTGGTGGG + Intergenic
931378514 2:61730409-61730431 TTGGTCCATTTGGCTTGGGTGGG + Intergenic
936593074 2:113821975-113821997 TGGCTACATTTGAAGCTGGTAGG - Intergenic
936618912 2:114074958-114074980 GTGGTCCATTTGGAGGTGGTTGG + Intergenic
939895077 2:147781930-147781952 TTGTTACAAATGGAGTTGGAGGG - Intergenic
941548649 2:166886559-166886581 TTGGCACATTTGGGGTTTGGAGG - Intergenic
944074823 2:195717149-195717171 TTGTTACATTTGGAGGTGTAAGG + Intronic
945526271 2:210891376-210891398 TTGCTAGCTTTGGAGTTGGTTGG - Intergenic
948134149 2:235623382-235623404 TTAGTTAATTTGGAGATGGTGGG + Intronic
1170846607 20:19967063-19967085 TTGGTAATTGTGGAGTTGCTGGG + Intronic
1173031374 20:39364311-39364333 TTGCTACATTTGCATTTGCTGGG - Intergenic
1174892047 20:54405725-54405747 TGGGTACATTTAGAGTTGTCTGG + Intergenic
1175393629 20:58643712-58643734 GTGGTACATTGGCAGGTGGTGGG + Intergenic
1177687525 21:24457542-24457564 CTGGTTCATTGGGAGTTGGCTGG - Intergenic
1178240554 21:30894641-30894663 CTGGTACAATTGGAATTGCTGGG + Intergenic
1179874123 21:44258994-44259016 TTGCTACATTTGGTTTTGCTGGG - Intronic
1183791503 22:40074342-40074364 TTAGTACATTTCAAGATGGTGGG + Intronic
949462369 3:4306442-4306464 TTGTTACATCTACAGTTGGTGGG + Intronic
951299709 3:20980093-20980115 TTGGTACATATGTATTTTGTTGG - Intergenic
952818719 3:37467705-37467727 GATGTAAATTTGGAGTTGGTGGG + Intronic
955143342 3:56291500-56291522 TTAGGAGATTTGGAGTTGGCAGG - Intronic
955709646 3:61764872-61764894 TTGTGACAATTGGAGATGGTTGG + Intronic
956068898 3:65426774-65426796 TTTGTACATCTGCAGTTGGCAGG - Intronic
956688104 3:71850822-71850844 TTGGGAGATTTGCAGTTTGTAGG + Intergenic
957425789 3:80037233-80037255 TTGTTTTATTTGGACTTGGTGGG + Intergenic
958574917 3:95936279-95936301 TTGGAACACTTGGACTTGGGGGG - Intergenic
958754031 3:98228491-98228513 TTAGTACATTTGGAGTTAACGGG + Intergenic
961103219 3:124219719-124219741 TTGGTCCATTTGATGTTTGTGGG + Intronic
962483184 3:135815603-135815625 TTGTTACATTTGGTGTTCCTGGG - Intergenic
964503294 3:157371747-157371769 GTGGATTATTTGGAGTTGGTAGG + Intronic
965841407 3:172909771-172909793 CTGCTACATTTGGAGTGGTTTGG + Intronic
966048107 3:175578021-175578043 TTGGTAGATTTGGAATTAGGAGG + Intronic
969572936 4:8020635-8020657 TTGGCGAATTTGCAGTTGGTTGG - Intronic
973616883 4:52687897-52687919 TTTGAACATTTGGAGGTTGTGGG + Intergenic
973624773 4:52760432-52760454 TTAGTACAGTTGGAGTGGGAGGG + Intergenic
976350709 4:84056817-84056839 TTGGTACATTTGAGGGTGGGAGG - Intergenic
976576471 4:86677962-86677984 TGGGGCCATTTGCAGTTGGTGGG + Intronic
977364677 4:96052871-96052893 TTGGTACATGTGGTGAGGGTTGG - Intergenic
979020613 4:115492513-115492535 TTGATATACTTGGATTTGGTTGG - Intergenic
986618466 5:9644592-9644614 ATGGTAAGTTTGGAGTTTGTGGG + Intronic
989958087 5:50377969-50377991 TAAGTACATCTGGAATTGGTGGG - Intergenic
989997428 5:50852602-50852624 TTTGTAGATTTGGAATTAGTGGG - Intergenic
996837996 5:127815416-127815438 TTGGCACATTTGGGGATGATAGG + Intergenic
998421509 5:141991566-141991588 TTGGTACATCTGGATTGGGCAGG + Intergenic
999792763 5:154957806-154957828 TAGCTACATTTAGAGTTGGAAGG - Intronic
999797548 5:155002497-155002519 TTTCTACATATGGAGATGGTAGG - Intergenic
1003898046 6:10626310-10626332 TTGGCACAGTTGTAGTTAGTCGG + Intronic
1008463118 6:51799004-51799026 TTGGTACATTTGGAGTTGGTAGG - Intronic
1009028491 6:58028420-58028442 TTGGCACATTTGTCGTTTGTTGG + Intergenic
1010866292 6:80980117-80980139 TTGGTTCATTTTGAGGTGGTAGG - Intergenic
1010906638 6:81499667-81499689 TTGCTAGCTTTGGAGTTGGTTGG + Intronic
1014408628 6:121085549-121085571 CTGTGACCTTTGGAGTTGGTTGG - Intronic
1014734862 6:125081053-125081075 GTGGCACATTTTGAGTTGGTAGG - Intronic
1017087488 6:150727708-150727730 TTGGTAAACCTGGAGGTGGTGGG - Intronic
1021759521 7:23890002-23890024 CTGGTACATTTTTAGTTGATTGG - Intergenic
1023409937 7:39880198-39880220 TTGTTAAATTTGGAATTCGTTGG + Intergenic
1024547269 7:50532855-50532877 TTGTTCCATTTGGATTTAGTGGG + Intronic
1025135848 7:56411908-56411930 TTGTTAAATTTGGAATTCGTTGG - Intergenic
1026629371 7:72024980-72025002 TAGGTACACATGGAGTTAGTAGG - Intronic
1028931078 7:96413879-96413901 TTGGTATAATTGGTGTGGGTTGG + Intergenic
1030208140 7:106970523-106970545 TTAGTTCATGTGGAGTTGGATGG - Intergenic
1033841041 7:145373790-145373812 TTGGTAAATTTGGAATTCATAGG - Intergenic
1038280659 8:26161287-26161309 TTGGTATATTAGGAGATGTTTGG + Intergenic
1042036351 8:64538549-64538571 CTGGAACATTTGGAGGAGGTGGG + Intergenic
1042503963 8:69539812-69539834 TTGGTGGAAGTGGAGTTGGTTGG + Intronic
1043088343 8:75866050-75866072 TGTGTACATTTGGTGGTGGTAGG - Intergenic
1043334870 8:79162959-79162981 GTGGTACTTTTGGAATTTGTTGG - Intergenic
1043518086 8:81014885-81014907 TTGGAGCTTTTGGAGGTGGTGGG + Intronic
1043983055 8:86662654-86662676 TTGCTACATTTGCAGTAGGGAGG + Intronic
1047015466 8:120718818-120718840 TTGTAACATTTGGAGTTTATAGG - Intronic
1047145990 8:122199963-122199985 CTGGTACATTTTTGGTTGGTAGG - Intergenic
1047157625 8:122338759-122338781 TTTGTACATTTTTAGATGGTTGG - Intergenic
1049416791 8:142499060-142499082 TTGGCACAGCTGGGGTTGGTGGG - Intronic
1051087842 9:13371564-13371586 CTGGTTCATGGGGAGTTGGTAGG + Intergenic
1053827686 9:42042700-42042722 TTGGTATATTTGGGGGTGGGGGG + Intronic
1054785685 9:69207947-69207969 TGGGTACACTTGTAGTTAGTTGG + Intronic
1055771320 9:79719772-79719794 TTGGTTAATTTGGTGGTGGTGGG + Intronic
1056734118 9:89190843-89190865 TTGGAACATTTGGATTTGAAAGG - Intergenic
1056784563 9:89580955-89580977 TTGGTGCATTGGGTGTTGGCTGG + Intergenic
1058109633 9:101018176-101018198 TTGGCACATTTGGAATGGCTTGG + Intergenic
1186455033 X:9703981-9704003 TTGGTACATTGGGAAGTTGTTGG + Intronic
1187014596 X:15313438-15313460 TTGGTAAATTTGGGGGTGGGGGG + Intronic
1187386753 X:18856068-18856090 TGTGTGCATTTGGAGTTTGTGGG + Intergenic
1189892662 X:45621611-45621633 TATGAAGATTTGGAGTTGGTGGG + Intergenic
1197900199 X:131363256-131363278 TTTTTTCATTTGGGGTTGGTGGG + Intronic
1198721323 X:139624207-139624229 TTTCTTCATTTGGAGTTTGTTGG - Intronic
1198798082 X:140420888-140420910 TTGATATGGTTGGAGTTGGTTGG + Intergenic
1199049689 X:143222435-143222457 TTGCTACATTTAGACTTGCTTGG - Intergenic
1199199336 X:145068631-145068653 TTAGTCCATGTGGAGTGGGTTGG - Intergenic
1199431154 X:147761322-147761344 TTGGTAGAATTGGAGAAGGTAGG - Intergenic