ID: 1008463152

View in Genome Browser
Species Human (GRCh38)
Location 6:51799501-51799523
Sequence TATTCCCAGCTGCTTCAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 170}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008463152 Original CRISPR TATTCCCAGCTGCTTCAAAC TGG Intronic
901778646 1:11577860-11577882 TATTCCCAGTGCCTTAAAACTGG + Intergenic
904413966 1:30343524-30343546 TATTCACAATAGCTTCAAACTGG - Intergenic
905075010 1:35262686-35262708 TAATCCCAGCTACTTGAACCCGG - Intergenic
905681936 1:39879532-39879554 TAGTCCCAGCTACTTGAGACAGG + Intronic
906299601 1:44672548-44672570 CAATCCCAGCTGCCTCCAACAGG + Intronic
906405709 1:45540247-45540269 TATTCCCAGCTACTTGAACCTGG - Intergenic
906974480 1:50555096-50555118 TAGTCCCAGCTACTTCAGTCAGG + Intronic
908092388 1:60699919-60699941 CATTCCCAGATGGTTCAAATGGG + Intergenic
908493471 1:64670181-64670203 TAGTCCCAGCTACTTGAGACTGG + Intronic
911189808 1:94936534-94936556 TATTCCCAATTGTTTCAAGCAGG - Intergenic
911209462 1:95124124-95124146 TATTCCCCTTTGTTTCAAACAGG + Intronic
912158400 1:106950662-106950684 TATCCCCAGCTGAATCAGACGGG + Intergenic
915268061 1:154732742-154732764 TATTCACAGCTCCCTCAAAATGG - Intronic
924042156 1:239994402-239994424 TATTCACAGCTGCTCCAAATTGG - Intergenic
1063886581 10:10585833-10585855 TCTTCCCAGTTGCTGCAAATTGG - Intergenic
1064441256 10:15355596-15355618 TAGTCCCAGCTACTTGAGACTGG + Intronic
1066365518 10:34772291-34772313 TAATCCCAGCTACTTCAGCCTGG + Intronic
1068300129 10:55128076-55128098 GATTCCTAACTGCTTCCAACTGG + Intronic
1071049444 10:81428639-81428661 TATCCCCAGCTGCCACATACTGG - Intergenic
1075517576 10:123120780-123120802 TACTCCCTGCAACTTCAAACTGG - Intergenic
1078460905 11:11514684-11514706 TGCTCCCAGCTGCTTCCATCTGG + Intronic
1078721330 11:13886577-13886599 TATTCATAACAGCTTCAAACTGG - Intergenic
1085444412 11:76590802-76590824 ATTTCCCAGCTCCTTCAAGCAGG - Intergenic
1088358718 11:108969349-108969371 TAATCCCTGCTGCTTTAATCAGG + Intergenic
1091557296 12:1583874-1583896 GATTCACAGCTGCTTCACAATGG + Intronic
1094265772 12:28557816-28557838 TAATCCCAGCTACTTGAATCCGG + Intronic
1100394994 12:94178030-94178052 TATTCCCAATTGATTCAAAAAGG + Intronic
1101048886 12:100840260-100840282 TAGTGCAAGCTGTTTCAAACTGG - Intronic
1101391043 12:104300764-104300786 TAATCCCTGCTACTTCAACCTGG - Intronic
1102744847 12:115241621-115241643 TAGTCCGTGCTGCTTCCAACAGG - Intergenic
1105732391 13:23231293-23231315 CATTCCCAGCTCATTCAAACAGG - Intronic
1106352172 13:28942531-28942553 TATTCCTAACAGCTCCAAACTGG + Intronic
1106488269 13:30191811-30191833 TAGTGCCAGCTGCTTCCCACAGG + Intergenic
1109734358 13:66462531-66462553 GTTTCCCAGCTGATTCTAACGGG - Intronic
1110262979 13:73506862-73506884 TAGTCCCAGCTGCTTGAAAGGGG + Intergenic
1110308342 13:74016842-74016864 GATTCCCAACTGCTGTAAACTGG + Intronic
1111201121 13:84938249-84938271 TATTCAAAACTGTTTCAAACTGG - Intergenic
1112243037 13:97701474-97701496 CATTACCACCTGCTTCTAACTGG + Intergenic
1113189300 13:107725589-107725611 TAGTCCCAGCTACTTGAACCAGG + Intronic
1113576196 13:111396801-111396823 TATTCCCAGGTGCCTCTCACTGG - Intergenic
1115193499 14:30771891-30771913 TGTGCCCAGCCACTTCAAACAGG + Intergenic
1116391525 14:44397125-44397147 TAGTCCCAGCTACTTGAAAGCGG - Intergenic
1117185998 14:53241504-53241526 TTTTCCCTGCTTCCTCAAACAGG - Intergenic
1119593238 14:75909712-75909734 TATGCCCAGTTGCTTAGAACTGG - Intronic
1120239997 14:81938948-81938970 AATTCCCAGATGCTTCAAAGGGG - Intergenic
1124389591 15:29242185-29242207 TAATCCCAGCTACTTGAACCGGG - Intronic
1124999762 15:34757245-34757267 ACTTCCCAGCTGCCTTAAACGGG - Intergenic
1125007940 15:34838973-34838995 GTTTCTAAGCTGCTTCAAACAGG + Intergenic
1125864387 15:43031477-43031499 TTTTCCCATCTGTTTCTAACTGG + Intronic
1125891497 15:43270288-43270310 TGTTCCCAGATGCTTCAGGCTGG - Intergenic
1126560662 15:50040283-50040305 TAGCCACAGCTGCTACAAACAGG + Intronic
1127397052 15:58551313-58551335 CATGAGCAGCTGCTTCAAACAGG - Intronic
1127506906 15:59606725-59606747 TAGTCCCAGCTACTTGAACCTGG - Intronic
1127924661 15:63527389-63527411 TATTCACAGCTGTTTCAACTGGG - Intronic
1129898323 15:79125089-79125111 AATTCCCTGCTTCCTCAAACTGG - Intergenic
1129933919 15:79433354-79433376 TCTTCCCTGCTGCTTAACACAGG - Intronic
1131646666 15:94352189-94352211 TATACCCAGCAGATTCAAACAGG - Intronic
1133481581 16:6175901-6175923 TTCTCCCAGGTGCTTCTAACAGG - Intronic
1135258366 16:20959890-20959912 TATTCCCAGGTGCCCAAAACGGG + Intronic
1139598031 16:67969169-67969191 AATCCCCAGCTGCCTCCAACAGG - Intronic
1140337989 16:74129654-74129676 TAATCCCAGCTACTTGAACCCGG + Intergenic
1141433153 16:83981260-83981282 TCATCTCAGCTGCTTCAAAGAGG - Intronic
1144196121 17:12896761-12896783 TCTTCCCAGTTGCTCCAAGCTGG - Intronic
1146315894 17:31806508-31806530 TATTCCCAGCTGCTCCCCATGGG + Intergenic
1147213011 17:38883085-38883107 TAATCCCAGCTGCTTTTAAAAGG + Intronic
1147256897 17:39186848-39186870 CATTCCCAGCCCCGTCAAACTGG - Exonic
1147638804 17:41981127-41981149 TAATCCCAGCTACTTGAACCCGG - Intronic
1149490020 17:57077922-57077944 TCTTCCCAGCTTCTTCCAATTGG - Intergenic
1149804703 17:59605333-59605355 AATTCCTATCTTCTTCAAACAGG - Intronic
1149820392 17:59771377-59771399 TAATCCCAGCAGTTTAAAACCGG - Intronic
1151685980 17:75646884-75646906 TATTCTCAGCTGCTCCAAGGAGG + Intronic
1152606630 17:81294822-81294844 CATGCCCTTCTGCTTCAAACAGG - Exonic
1152920296 17:83063195-83063217 TGTTCCCAGCTGCCTCATCCTGG - Intergenic
1153472741 18:5465111-5465133 TAATCTCAGCAGGTTCAAACAGG + Intronic
1156376901 18:36522974-36522996 TATCCCTAGCTGCTTAAAACTGG + Intronic
1158104904 18:53874349-53874371 CACCCCCAGCTGCTTCAAGCAGG - Intergenic
1161193865 19:2975255-2975277 TAATCCCAGCTACTTGAACCTGG - Intergenic
1162126986 19:8504962-8504984 TAATCCCAGCTACTTGAAGCCGG - Intergenic
1163976351 19:20856729-20856751 CATTCACAGCTGCTACAAAGAGG + Intronic
1165598208 19:37029639-37029661 TAATCCCAGCTACTTGAATCTGG - Intronic
927042547 2:19244346-19244368 GATTCCCTGCTACTTCAGACTGG + Intergenic
927780964 2:25939085-25939107 TAATCCCAGCTACTTGAATCTGG - Intronic
928189669 2:29151914-29151936 TACTCCCAGCTGCTGCAGATAGG + Intronic
929985119 2:46722603-46722625 TATTCACAATTGCTCCAAACTGG - Intronic
930840413 2:55839161-55839183 AATTCCCAGCAGCTTCAATCTGG - Intergenic
935734285 2:106094468-106094490 TCTTGCCAGCCGATTCAAACTGG - Intronic
936033420 2:109089948-109089970 TCCTCCCAGCTGATGCAAACTGG + Intergenic
940321891 2:152386176-152386198 TATTCCCAGCACCTTCAAGGGGG + Intronic
941822193 2:169855091-169855113 TATTCCCAGATGAGTCAACCTGG - Intronic
941930774 2:170936697-170936719 TAATCCCAGCTACTCCAATCAGG + Intronic
943194322 2:184724164-184724186 TACTACCAGCTGCTTGAAGCAGG - Intronic
945214391 2:207417847-207417869 CATTCCCAGCAGCTCCAAATTGG + Intergenic
945466471 2:210175396-210175418 TATTCACAACAGCCTCAAACTGG + Intergenic
1171290175 20:23978668-23978690 CACTCCCAGCTTCTTAAAACAGG + Intergenic
1172945390 20:38683672-38683694 CCTTCCCAGCTGCTACAACCTGG - Intergenic
1174792986 20:53497610-53497632 GAGTTCCAGCTGCTTGAAACTGG + Intergenic
1174974278 20:55313852-55313874 TATTCCCAGCTAATTCACACTGG + Intergenic
1175024746 20:55889951-55889973 TATTCCCAGCAGCATAAAGCTGG - Intergenic
1175552471 20:59826372-59826394 TCTTCCCAGCTGACTCAACCTGG + Intronic
1178879523 21:36437745-36437767 TAATCCCAGCTACTTGAACCTGG + Intergenic
1180767259 22:18352362-18352384 CACTCCCAGCTTCTTAAAACTGG - Intergenic
1180779050 22:18510017-18510039 CACTCCCAGCTTCTTAAAACTGG + Intergenic
1180811771 22:18767337-18767359 CACTCCCAGCTTCTTAAAACTGG + Intergenic
1181197924 22:21201579-21201601 CACTCCCAGCTTCTTAAAACTGG + Intergenic
1181401821 22:22654227-22654249 CACTCCCAGCTTCTTAAAACAGG - Intergenic
1181447164 22:22986217-22986239 TCTCCCCAGCTTCTTCATACTGG + Intergenic
1181703775 22:24635321-24635343 CACTCCCAGCTTCTTAAAACAGG - Intergenic
1203228881 22_KI270731v1_random:93256-93278 CACTCCCAGCTTCTTAAAACTGG - Intergenic
951828358 3:26894741-26894763 TATTCCCAGCTGGTAAAAACAGG + Intergenic
952033935 3:29177396-29177418 TATTCACAGCAGCCCCAAACTGG - Intergenic
952761572 3:36919547-36919569 TATTCACAGTTGTCTCAAACTGG - Intronic
953477194 3:43215509-43215531 ATTTCCCAGCTGCCTCCAACAGG - Intergenic
953730521 3:45443573-45443595 TATTCCCATCTGCTGCACACAGG - Intronic
955288020 3:57663055-57663077 TACTCCCAGCTACTTGAACCTGG + Intronic
955576532 3:60370758-60370780 TATTCCCACAGCCTTCAAACTGG + Intronic
959623972 3:108428729-108428751 TATTTCCAGCTGAGCCAAACTGG + Exonic
962860153 3:139392070-139392092 TTCTCCCAGCTGCTGCAAAAAGG - Intergenic
965584629 3:170306600-170306622 TAGTCCCAGCTACTCCAAGCTGG - Intergenic
965874924 3:173305281-173305303 TATTCAAAACAGCTTCAAACTGG - Intergenic
975452088 4:74540396-74540418 TATTGCCAGCTACTTCAAATAGG - Intergenic
976566230 4:86553540-86553562 TTATCCCAGCTGCTTAAAAGAGG + Intronic
978256226 4:106695904-106695926 AATCCCCAGCTGCCTCAAATTGG - Intergenic
978399531 4:108315939-108315961 TATTCCTAGCTGTTCCAAAGTGG - Intergenic
979894766 4:126145725-126145747 TTCTCACAGCTGCTTCAAGCGGG + Intergenic
984202063 4:176735773-176735795 TCATGCCAGCTGCTTCAAAGAGG + Intronic
984610507 4:181831914-181831936 TATTCCCTGATGCTTCATGCAGG - Intergenic
985185693 4:187312985-187313007 TAGTCTCTGCTGCTTCAAAGGGG + Intergenic
987259279 5:16187478-16187500 TATTCCCAGCACCTGCAACCAGG + Intergenic
987931434 5:24403980-24404002 TATTCTGAGATGCTTCTAACTGG + Intergenic
988320848 5:29694292-29694314 TCCTCCCAGCTGCTCCAAAATGG - Intergenic
989384364 5:40839723-40839745 TAGTCCCAGCTGCTTGGGACAGG - Intergenic
990690233 5:58355454-58355476 TATTTCCTCCTGCTTCAAAGTGG - Intergenic
991632330 5:68668657-68668679 TATTCCTAGCTACTAAAAACTGG - Intergenic
992650639 5:78855829-78855851 CATTCCCAGCTGCTTCCAATTGG + Intronic
993869915 5:93240469-93240491 TAGTCCCAGCAGCTTGAAATGGG - Intergenic
998189086 5:140007302-140007324 TAGTGCCTTCTGCTTCAAACAGG + Intronic
998813896 5:145993244-145993266 TCCTCCCAGCTGCTTTACACAGG + Intronic
999622845 5:153490287-153490309 CATTCCCAGCAGCTTCAGCCTGG + Intronic
1001698625 5:173690684-173690706 AATTCCCAGCTGCTTCACTGTGG - Intergenic
1001859077 5:175037453-175037475 TATTCCCAGATAGTTCAAATAGG + Intergenic
1003841279 6:10122994-10123016 TATTCCTCACAGCTTCAAACTGG - Intronic
1004219234 6:13731243-13731265 TTTTCCCTGCTGCCTCACACAGG - Intergenic
1004442685 6:15669214-15669236 CTTTCCCAGCTCATTCAAACAGG + Intergenic
1005002820 6:21259834-21259856 TAATCCCAGCTGTTAAAAACAGG - Intergenic
1006982267 6:38155966-38155988 TATTCACAGCTGAGTCACACAGG - Intergenic
1007405891 6:41636198-41636220 TAGTCCCAGCTGCTTTAACTTGG + Intergenic
1007959756 6:45947862-45947884 TATACTCAGCTGCTTCCAATGGG + Intronic
1008310683 6:49968774-49968796 TATTCCCAGCTGTTGCATTCCGG + Exonic
1008354266 6:50532968-50532990 TATTCCAAGCTGCTTTTTACTGG + Intergenic
1008463152 6:51799501-51799523 TATTCCCAGCTGCTTCAAACTGG + Intronic
1009983637 6:70756760-70756782 CATTCACAGTTGCTTCAAAGAGG + Intronic
1016507023 6:144793970-144793992 TGTTCGCAGCTGCTTCCAACAGG + Exonic
1019341686 7:511541-511563 TAGTCCCAGCTGATGCAAGCAGG - Intronic
1020330863 7:7015722-7015744 TATTCCCAGCTACTCCAGCCTGG - Intergenic
1022233627 7:28439730-28439752 TATTCCCAGATGCCTCAAATTGG + Intronic
1023109758 7:36797361-36797383 CATTCCCAGCTGCTACCAAGTGG + Intergenic
1026540193 7:71273379-71273401 TATTCCCAGTTGGTTCTGACAGG + Intronic
1026958362 7:74392705-74392727 TAATCCCAGCTACTTCAGGCAGG + Intronic
1027478125 7:78659329-78659351 TAGTCCCAGCTTCTTGAACCCGG + Intronic
1027789998 7:82627606-82627628 TTTTCCCAGCTAATTTAAACAGG - Intergenic
1027862851 7:83607053-83607075 TATTTCCAGTTGCACCAAACAGG - Intronic
1031464147 7:122087600-122087622 TAATCCCAGCTACTTCACTCGGG + Intronic
1034596774 7:152203689-152203711 TATTCTCAGATGCTTCATAATGG + Intronic
1035202357 7:157275891-157275913 AATTCCAAGCTTCTTCAAATGGG - Intergenic
1035616286 8:1004402-1004424 TATTACCTGCTGTTTCAAATAGG + Intergenic
1035945395 8:3955911-3955933 TAATCCCAGCTGCTTTAACCCGG - Intronic
1039796993 8:40924179-40924201 TGTTCCCAGCAGCATCAAGCTGG - Intergenic
1040561390 8:48525915-48525937 TACTCCCAGCTCCCCCAAACAGG - Intergenic
1041906276 8:63037129-63037151 TATTCCCAGCTTCTTACAATTGG + Intronic
1047683299 8:127277145-127277167 AACTCCCAGCTGCTCCACACTGG + Intergenic
1051223211 9:14872417-14872439 CATTCACAGTTGCTTCAAAGAGG - Intronic
1053559894 9:39181071-39181093 TATTCCCAGCTACTTGGAAGGGG + Intronic
1053824003 9:42001292-42001314 TATTCCCAGCTACTTGGAAGGGG + Intronic
1054137222 9:61437884-61437906 TATTCCCAGCTACTTGGAAGGGG - Intergenic
1054606570 9:67186071-67186093 TATTCCCAGCTACTTGGAAGGGG - Intergenic
1057397359 9:94692019-94692041 AAGTCCCAGTTGCTCCAAACAGG + Intergenic
1058891186 9:109362118-109362140 TAGTCCCAGCTACTTCAAGGAGG + Intergenic
1059537741 9:115098396-115098418 TATTCCCTGCTGCTTCCAAAAGG - Intronic
1060174056 9:121484401-121484423 TAATCCCAGCTACTTCAGCCTGG - Intergenic
1060265566 9:122109790-122109812 CATCCCCTGTTGCTTCAAACTGG - Intergenic
1061363595 9:130158740-130158762 TAATCCCAGCTACTCCAGACGGG + Intergenic
1062120800 9:134833091-134833113 CATTCCCTGATGCTGCAAACAGG + Intronic
1188254383 X:27942495-27942517 TATGCACAGATGCTTCAAGCTGG + Intergenic
1191170102 X:57436685-57436707 TATTACCTCCTGATTCAAACGGG - Intronic
1194307799 X:92270231-92270253 TAATCCCAGCTACTTGGAACAGG - Intronic
1194518820 X:94892922-94892944 TATTCCTAACTGCTACAAATTGG - Intergenic
1195040520 X:101009939-101009961 TATTACCAGCTGCTTAAAAAAGG + Exonic
1198581158 X:138066272-138066294 TATTCCCAGCTCCATCATTCTGG + Intergenic
1200315016 X:155123490-155123512 TTTTCCCAGCTGCACCAATCTGG + Intronic