ID: 1008463775

View in Genome Browser
Species Human (GRCh38)
Location 6:51806673-51806695
Sequence CGTTATCTAAAAATAGATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 167}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008463772_1008463775 8 Left 1008463772 6:51806642-51806664 CCAAAAATCACCAAGACAGAATG 0: 1
1: 0
2: 1
3: 34
4: 415
Right 1008463775 6:51806673-51806695 CGTTATCTAAAAATAGATGAGGG 0: 1
1: 0
2: 0
3: 10
4: 167
1008463773_1008463775 -2 Left 1008463773 6:51806652-51806674 CCAAGACAGAATGAGAAGAATCG 0: 1
1: 0
2: 0
3: 7
4: 137
Right 1008463775 6:51806673-51806695 CGTTATCTAAAAATAGATGAGGG 0: 1
1: 0
2: 0
3: 10
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008463775 Original CRISPR CGTTATCTAAAAATAGATGA GGG Intronic
903247875 1:22029575-22029597 TGTTATATAAAAATAGTTGGAGG + Intergenic
906387018 1:45378704-45378726 TGTTATGTAACAATAGATCATGG + Intronic
908830440 1:68173466-68173488 CTGTGTCTAAAAATAGATGATGG + Intronic
909090771 1:71222754-71222776 CTTTTTCTGAAAATAGCTGAGGG + Intergenic
909546079 1:76848525-76848547 CTTTTTATAAAAATAGAAGAGGG - Intergenic
910206955 1:84757863-84757885 CGTTACCTAACACTAGATCAAGG - Intergenic
913193772 1:116435789-116435811 AGTTAACTCAAAATAGATCATGG - Intergenic
914727930 1:150343925-150343947 CATTATCTGAAAATTTATGAAGG - Intronic
915494074 1:156268708-156268730 CTATGTTTAAAAATAGATGAAGG - Intronic
917430357 1:174961469-174961491 CGTTCTCCAAAGGTAGATGAAGG - Intronic
918590821 1:186239054-186239076 AGTTATCTAAGTACAGATGAGGG + Intergenic
919557014 1:199069978-199070000 AGATATTTAAAAATATATGAAGG + Intergenic
921117022 1:212101474-212101496 CTTTATCTATAAAAAGAGGATGG - Intronic
924874596 1:248088649-248088671 AGTTATCTAAAACAAGATAAGGG + Intronic
1063252239 10:4286324-4286346 CGTTATCTAGAAGCAGCTGAAGG - Intergenic
1067034971 10:42908050-42908072 CATAATCAAAAAATAGATGTTGG + Intergenic
1069218129 10:65848442-65848464 CCTTATCTAAATATTGAAGAAGG + Intergenic
1070447367 10:76520411-76520433 CGTCATCTTGAAATAGAAGAGGG - Intronic
1071417592 10:85455561-85455583 CAATATCGAAAAATAGAAGAGGG + Intergenic
1071749889 10:88462940-88462962 CTTTATTTAAAAGTACATGATGG + Intronic
1073522730 10:104149488-104149510 CATTATCTAAAAACTGATAAAGG - Intronic
1074620861 10:115119306-115119328 TTTTATCTAAAAGTAGATAATGG + Intronic
1077574084 11:3366510-3366532 TTTGATTTAAAAATAGATGAAGG + Intronic
1077682952 11:4263013-4263035 CGACTTCTAAAATTAGATGAAGG + Intergenic
1077687090 11:4303745-4303767 CGACTTCTAAAATTAGATGAAGG - Intergenic
1077692251 11:4354934-4354956 CGACTTCTAAAATTAGATGAAGG - Intergenic
1079748630 11:24165641-24165663 CATTATTAAAAAATAAATGAAGG + Intergenic
1079770791 11:24456525-24456547 AATTAACTAAAAATTGATGATGG - Intergenic
1081177257 11:39944383-39944405 GGTTATTTGAAAATACATGAAGG - Intergenic
1081371275 11:42306627-42306649 CATTATCTAAACATAAATCATGG - Intergenic
1089363486 11:117906662-117906684 AGTAAACAAAAAATAGATGAAGG + Intronic
1092509562 12:9140489-9140511 CGTTATTAAAAAATAAATCATGG + Intergenic
1096131788 12:49165072-49165094 CATTTTTTAAAAACAGATGATGG + Intergenic
1096704817 12:53413365-53413387 CTTTGGCTACAAATAGATGATGG + Intronic
1098538984 12:71630190-71630212 TGTTTTCAAAAAATAGAGGAAGG - Intronic
1098985870 12:77011410-77011432 TGTAATTTAAAAATAGCTGATGG - Intergenic
1099631903 12:85160231-85160253 TGTTATCTGAAAATACATTAGGG + Intronic
1101443267 12:104719285-104719307 CCTTATCTAGAAAGAGATGCTGG - Intronic
1104836073 12:131791773-131791795 CTTTTTTAAAAAATAGATGAAGG + Intronic
1106491896 13:30233443-30233465 AGATAGCTAATAATAGATGATGG + Intronic
1106758120 13:32842526-32842548 AGTCATCTAAATGTAGATGAGGG - Intergenic
1107886108 13:44875279-44875301 GGTTACCTAAAAGTAGAAGAAGG - Intergenic
1109207289 13:59496699-59496721 CGTTATCTACAAATATAGGTTGG + Intergenic
1110325153 13:74205515-74205537 TATTATCTAAAAATTGATGTTGG + Intergenic
1113148323 13:107234214-107234236 CCTTATTTAAAAATATAGGAAGG - Intronic
1115007553 14:28504265-28504287 AATTATCTAAATATAGATAAAGG + Intergenic
1116182327 14:41550913-41550935 CGTGTTCTTAAAATAAATGATGG + Intergenic
1117659270 14:57987109-57987131 CGATATGTCAAGATAGATGAAGG - Intergenic
1117840255 14:59853438-59853460 AGCTGTCTAAAAATACATGAAGG - Intronic
1118214842 14:63798989-63799011 CATTTTCTAAATATAGATGCTGG + Intergenic
1121334943 14:93071649-93071671 TGTAATTTAAAAATGGATGATGG - Intronic
1123787648 15:23688795-23688817 AGATATCTATAAATAGAAGAAGG - Intergenic
1124908576 15:33895822-33895844 CCTTATCTAAAATTAGTGGAGGG - Intronic
1126501202 15:49347383-49347405 GGTTGTTTAAAAGTAGATGAAGG + Intronic
1127512122 15:59653195-59653217 CGTGATTTAGAAACAGATGAGGG + Intronic
1128029125 15:64463724-64463746 TGTTATCAAAAAATATATAAAGG - Intronic
1130173629 15:81544607-81544629 GGTTATCTGAGAATAGATAATGG + Intergenic
1130617668 15:85427726-85427748 AGTTATGGAAATATAGATGAAGG + Intronic
1134911803 16:18034048-18034070 CATGATTTAAAAATGGATGAAGG - Intergenic
1139735741 16:68986592-68986614 CGTTTTCTAAAATTGGATTATGG - Intronic
1144786261 17:17833680-17833702 CGTTTTTAAAAAATTGATGAAGG + Intronic
1147489364 17:40850190-40850212 AGTTATCTTAAAATGGCTGATGG - Intergenic
1150694124 17:67389564-67389586 TGCCATTTAAAAATAGATGATGG + Intronic
1155445581 18:25908754-25908776 CTTTTTCAAAAAATAGAGGAGGG - Intergenic
1155826644 18:30452846-30452868 AGTTATTTAAAAATATATAATGG - Intergenic
1155875263 18:31079029-31079051 CATTATATAAAAATAAATCATGG - Intronic
1157320949 18:46633788-46633810 CTTAATTTAAAAATGGATGAAGG + Intronic
1157955145 18:52088581-52088603 CTTTATCATAAAATAGAAGAGGG + Intergenic
1158978402 18:62734733-62734755 TGTTATTTAATAATAGATGGTGG - Intronic
1159829380 18:73255606-73255628 AGTTAACTCAAAATGGATGATGG + Intronic
1162144721 19:8606652-8606674 CCTCATCTATAAAAAGATGAGGG - Intronic
1164694974 19:30236623-30236645 CATCATCTAAAAATGGATTAAGG + Intronic
1165979816 19:39711102-39711124 TATTATCTAAAAATCAATGAAGG + Intergenic
1166615326 19:44239210-44239232 ATTTATTTAAAAATACATGATGG - Intronic
926794590 2:16608435-16608457 TGCGATCTTAAAATAGATGAGGG - Intronic
927013347 2:18929479-18929501 AGCTATTTAAAACTAGATGATGG + Intergenic
930307231 2:49690234-49690256 AGTTAACTCAAAATAGATCATGG - Intergenic
930337384 2:50066594-50066616 ATTTATTTAAAAATAGATGTTGG - Intronic
931224168 2:60315337-60315359 TGTTGTCTACAGATAGATGAAGG - Intergenic
933170474 2:79119371-79119393 CTTTATATAAAAACTGATGATGG - Intergenic
935757023 2:106284163-106284185 CCGTATCCAGAAATAGATGATGG + Intergenic
935809703 2:106785631-106785653 CATTATGAAAAAATAGATGTTGG + Intergenic
936112545 2:109676872-109676894 CCGTATCTAGACATAGATGATGG - Intergenic
937212528 2:120284713-120284735 AGTGATCTAAAATTAGATAATGG - Intronic
939422501 2:141992006-141992028 GGTTATATAAAAATATACGAGGG - Intronic
939835859 2:147128872-147128894 CGTAATTTAAAAATATAAGAAGG + Intergenic
939951908 2:148485430-148485452 TAAAATCTAAAAATAGATGAAGG + Intronic
941669727 2:168280005-168280027 CGATATATAAAAACAGATGGAGG + Intergenic
945071813 2:205997874-205997896 GCTTATATAAAAATAGATAAAGG - Exonic
945690588 2:213030006-213030028 CATAATTTAAAAATAGGTGAAGG - Intronic
947804459 2:232955904-232955926 TGTTTTCTAATATTAGATGAAGG + Intronic
948286150 2:236787026-236787048 CCTTATCTAAGAGTAGAGGAGGG + Intergenic
1169496087 20:6116766-6116788 CGGTATCTAAATGTAAATGATGG - Intronic
1170048201 20:12109892-12109914 TGTTATCTGAAAAGAGGTGATGG - Intergenic
1173568822 20:44063442-44063464 CATAATCAAAAAATAGATGTTGG + Intronic
1175177934 20:57124690-57124712 CGTTATCTATAAAATGAGGAAGG + Intergenic
1183548283 22:38467124-38467146 CGTTATTTAGAGAGAGATGAGGG + Intergenic
949995786 3:9615670-9615692 CGTTCTCTAAAAAAAGAGAAAGG + Intergenic
950987427 3:17389959-17389981 GGATAGCTAAAAATTGATGAAGG - Intronic
956173401 3:66450996-66451018 CCTTAGCTAAAAAGACATGAAGG - Intronic
958564325 3:95788535-95788557 CTTTATCCAAAAATAAATTAAGG + Intergenic
962177058 3:133166332-133166354 CGTAAACTAAAAATAGAAGTTGG + Intronic
962520459 3:136193999-136194021 CTTTATTTAAAAGTAGATAAAGG - Intronic
962698454 3:137973869-137973891 AGTTATTTATAAATAAATGATGG + Intergenic
964093927 3:152909623-152909645 TGTTATCTAGAAATAGCAGAGGG + Intergenic
964194671 3:154048721-154048743 TGTTATGTAATAATAGATGAAGG + Intergenic
964311439 3:155397745-155397767 AGAAAACTAAAAATAGATGAAGG - Intronic
965110691 3:164417672-164417694 CATTATCTATAAATATATTATGG - Intergenic
965346166 3:167553482-167553504 GGATATCTAAAAATAAATTAAGG + Intronic
965436132 3:168653978-168654000 CATTATTTAAAAATTGATGAAGG - Intergenic
965936052 3:174114041-174114063 CTTAATCTAAAAATAAAGGAGGG - Intronic
967782995 3:193459815-193459837 TCTTATCTAAAATGAGATGATGG - Intronic
973335833 4:48955468-48955490 CTTTGTCTGAAAATAGAAGAGGG - Intergenic
974541069 4:63236405-63236427 AGTTATCTAAAAGATGATGAAGG + Intergenic
975263633 4:72335086-72335108 AGTTAACCAAAAATAGATTATGG + Intronic
975410220 4:74039864-74039886 CATTATCTAAAACTAGAAAAAGG - Intergenic
977894936 4:102352646-102352668 AGTTATCAAAATGTAGATGATGG + Intronic
980481492 4:133394228-133394250 CATTATCTAAAGAAAGATGATGG + Intergenic
980965483 4:139516821-139516843 GGTGTTCTAAAATTAGATGATGG - Intronic
981755096 4:148134422-148134444 CCTTTTCTCAAGATAGATGAGGG + Intronic
981806415 4:148720735-148720757 CCTTAGGTAAAAATAGAGGAAGG + Intergenic
981878959 4:149585081-149585103 GGTTATAGAAAAAAAGATGATGG - Intergenic
983166438 4:164482598-164482620 CCTTATCTAAAAATAAATTAAGG + Intergenic
993415074 5:87617854-87617876 CATCATCTAAAAATAGACTATGG - Intergenic
993928070 5:93897309-93897331 CCTTATCTATAAATAGCTTAAGG - Intronic
993958043 5:94261505-94261527 CCTTAAATAAAAATAGATGTTGG + Intronic
1000114898 5:158144680-158144702 GGTAATCAAAAAGTAGATGAGGG - Intergenic
1000503069 5:162076960-162076982 CTTTATTTAAAAATAGTTGCAGG - Intronic
1002440316 5:179261131-179261153 CAATATCTAAAAAGAGATAAAGG + Intronic
1002930725 6:1633257-1633279 GATTATCTAAAATTAGAGGAAGG - Intronic
1008463775 6:51806673-51806695 CGTTATCTAAAAATAGATGAGGG + Intronic
1008903170 6:56646353-56646375 GGTTATCTAAAATTTGATGAGGG + Intronic
1010434807 6:75817000-75817022 CCTCATCTAAAAGTAGATAAAGG + Intronic
1011841653 6:91508418-91508440 CGTATTCTAAAATGAGATGAGGG - Intergenic
1012109338 6:95207707-95207729 CATTATCTAAAAATAAATGTGGG + Intergenic
1013250279 6:108326656-108326678 CTTTATTTAAAAATGAATGAGGG + Intronic
1015520706 6:134128328-134128350 CATTTTCTAAAATTAGATTATGG + Intergenic
1017366458 6:153646998-153647020 AGTTATTTAAAAATAAATTATGG + Intergenic
1017923917 6:158894641-158894663 CTTTAACAAAAAACAGATGAAGG - Intronic
1018232943 6:161693277-161693299 ATTTATCTAAAAATAAATCATGG + Intronic
1022257838 7:28677092-28677114 TTTTATCTTAAAATAGAAGAGGG + Intronic
1024402300 7:48939053-48939075 TGGTATCTAAAAACAGATGAAGG - Intergenic
1027565227 7:79783483-79783505 CTCTATTTAAAAATAGATAAAGG - Intergenic
1027593401 7:80141904-80141926 TGTTATCAAAAACTAGAGGAAGG - Intronic
1027688744 7:81313500-81313522 CTTTATCTTAAAATAAATTATGG - Intergenic
1028302111 7:89213019-89213041 AGTTATCTCAGAATAGATTAAGG - Intronic
1029264444 7:99327107-99327129 AGGTATCTAAAAACAGAGGAGGG + Intronic
1032097126 7:128945118-128945140 CCCTATCTCAAAAAAGATGAGGG - Intronic
1033613545 7:142988780-142988802 CATTATATATAAATATATGATGG - Intergenic
1034886230 7:154801151-154801173 CGTTTTCTAAAAGAAGAAGATGG - Intronic
1035317340 7:158004427-158004449 AGTTCTTTAAAAATAGATGCTGG - Intronic
1036118794 8:5991544-5991566 CCTCATTTCAAAATAGATGAAGG + Intergenic
1037397054 8:18454246-18454268 TGTTATATAAACATAGATGTGGG + Intergenic
1038051036 8:23811728-23811750 AGTTATTTAATAATATATGAAGG + Intergenic
1038166218 8:25087610-25087632 CGATATCCAAAAATTAATGATGG - Intergenic
1039095707 8:33882058-33882080 TGTTGTCTATAGATAGATGATGG + Intergenic
1043623947 8:82231193-82231215 CTATATCTAAAAAAAGAAGAAGG + Intergenic
1043663173 8:82772567-82772589 CTTTAGCCCAAAATAGATGATGG + Intergenic
1046303891 8:112336208-112336230 CTTTATTTAAAAATATATTAAGG - Intronic
1046731648 8:117732556-117732578 TGTTATTTAAAAATAAATAAAGG - Intergenic
1048003156 8:130396247-130396269 CGTTTTCTAAAAACAAATGAAGG + Intronic
1049985642 9:948285-948307 CGTTATCTTAAATGAGATGAAGG + Intronic
1051417623 9:16859018-16859040 CCTGATTTAAAAATAGGTGAAGG + Intronic
1055883238 9:81027683-81027705 CATAATATTAAAATAGATGAGGG + Intergenic
1056943748 9:90976521-90976543 CTTTATCTAAGAATAGAGGTAGG - Intergenic
1057975549 9:99602274-99602296 CTTCATCTTAAAATATATGAAGG - Intergenic
1059086991 9:111314290-111314312 AATTAACTAAAAATAGATCAAGG - Intergenic
1059624041 9:116041710-116041732 CGTTAGCTAAAAATAGGAAAAGG - Intergenic
1059784598 9:117567051-117567073 CATTATCTATAAAATGATGAGGG + Intergenic
1186211894 X:7258298-7258320 TGTTATATATAAATAGATGCAGG + Intronic
1188704982 X:33316470-33316492 CATTAACTCAAAATAGATCATGG - Intronic
1189236636 X:39492081-39492103 GCTTCTCTAATAATAGATGATGG + Intergenic
1190497151 X:51037680-51037702 TGTTCTCTGAAAATGGATGAAGG - Intergenic
1190508831 X:51156583-51156605 TGTTCTCTGAAAATGGATGAAGG + Intergenic
1196504345 X:116423879-116423901 GGATATCTCAAAATAGGTGAGGG - Intergenic
1198965320 X:142222438-142222460 AGTTATTTAAAAATAAATGTAGG - Intergenic
1200129747 X:153834797-153834819 CATTATCTCAAAACAGATCATGG - Intergenic
1201315145 Y:12637389-12637411 TGTAATTTAAAAATGGATGAAGG - Intergenic