ID: 1008465551

View in Genome Browser
Species Human (GRCh38)
Location 6:51826305-51826327
Sequence CCCATTCATGTCTTCAAATA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 166}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008465551 Original CRISPR CCCATTCATGTCTTCAAATA AGG Intronic
903572022 1:24313098-24313120 TCCATCCATGCCTTCAAAGAAGG + Intergenic
905514251 1:38550277-38550299 CCCAATCAAGTCTTCATACAAGG - Intergenic
907382371 1:54101939-54101961 CCCATTTGTGTTTTCAAAAATGG - Intronic
908145548 1:61237652-61237674 CCCATCATTGTTTTCAAATATGG + Intronic
911370530 1:96989521-96989543 TCTATTCATGTCTTTGAATAGGG - Intergenic
913118970 1:115722107-115722129 CTCATTCAAGTCTCCAACTAGGG - Intronic
915355684 1:155254320-155254342 CCCATTTATGTCCTCAAGAAGGG - Intronic
917028459 1:170665546-170665568 ACCATTTTTGTCTTCAAATTTGG + Intronic
917627813 1:176863614-176863636 CCCAGTCCTGGCTTAAAATAAGG + Exonic
918601540 1:186368950-186368972 AACATTCATTTCTTCAAATGTGG + Intronic
918891533 1:190278033-190278055 CCCATTAAAGGCTTCAAGTATGG + Intronic
918946202 1:191069005-191069027 CCTATTCTTGACTTAAAATAAGG + Intergenic
920259881 1:204681983-204682005 CCCATTCAAGCCTCCAACTATGG + Intronic
922913166 1:229234251-229234273 GCCAATCAAGTCTTCAAATACGG - Intergenic
923393709 1:233540175-233540197 CCCAGGCATGTCTTCAACTTTGG - Intergenic
924191960 1:241562825-241562847 CCCAATCCTGTCTTGAAAGAAGG + Intronic
924297881 1:242607114-242607136 CTCATTCCTGTCATCAAACAAGG + Intergenic
1063704491 10:8417740-8417762 CCCTTTCATGTCTTCAGTTCTGG + Intergenic
1065863286 10:29889921-29889943 CAAATTCTAGTCTTCAAATAAGG - Intergenic
1071370134 10:84942818-84942840 CCCATTCAAGTTTTCACATCTGG + Intergenic
1074348591 10:112712866-112712888 CCCATTGTTGTCTTTAAATTTGG + Intronic
1077767348 11:5174303-5174325 CCTATTCATGACATTAAATAAGG - Intronic
1078317893 11:10307202-10307224 GACATTCACGTCTTAAAATAGGG - Exonic
1078588601 11:12617818-12617840 CCCATGCCTATCTTCAAAAATGG + Intergenic
1079138489 11:17791462-17791484 ACCATTTTTGTCTTCAAATTAGG - Intronic
1081944619 11:46979306-46979328 GCCACTCATGTTTTCAAACAGGG - Intronic
1085472327 11:76766404-76766426 CCTCTTCACGTCTGCAAATAGGG + Intergenic
1087151317 11:94862064-94862086 CCCATCCAAGACTCCAAATAAGG - Intronic
1087973933 11:104520480-104520502 CCCACTCAACTCTTAAAATATGG - Intergenic
1090550996 11:127819861-127819883 CCCTTTCTTGGCTTCAAACATGG - Intergenic
1091079294 11:132651550-132651572 CCTAGTCATGTTTACAAATAAGG - Intronic
1093699581 12:22203762-22203784 CCCACCCATATCTTCTAATATGG + Intronic
1096446241 12:51694921-51694943 GGCATTGATGTCTGCAAATATGG + Intronic
1097424567 12:59427577-59427599 CCCATTCAAGACTTCTAATAAGG + Intergenic
1098547222 12:71725044-71725066 CTCATTCCTTTCATCAAATAAGG - Intergenic
1099726176 12:86431024-86431046 CCCCTTCATTTCTTCAAAAAGGG + Intronic
1100872806 12:98929400-98929422 CTCATTAATTTCTACAAATAAGG - Intronic
1102126483 12:110486243-110486265 AACATTCATCTCTTCAGATAAGG + Intronic
1107134778 13:36932151-36932173 CCCACTAATGTTTTCAACTATGG - Intergenic
1107790587 13:43998334-43998356 CCTTTTTATCTCTTCAAATAAGG + Intergenic
1108839826 13:54599045-54599067 TCTATTAATGTCTTCAAATATGG - Intergenic
1109505654 13:63299457-63299479 CCCATTCATTTCTTCCATAAAGG - Intergenic
1110108001 13:71704039-71704061 ACATTTCATCTCTTCAAATAAGG + Intronic
1112066108 13:95794905-95794927 CTCAGACATGTCTACAAATATGG + Exonic
1112213651 13:97407131-97407153 CAGTTTAATGTCTTCAAATATGG + Intergenic
1116085363 14:40230574-40230596 CACATTAATGCCTTCAAAAAAGG + Intergenic
1117540287 14:56740366-56740388 CCCATTCAGCTCTACCAATAAGG - Intergenic
1121005894 14:90490524-90490546 TCCATTCATGGCTTTAAACATGG - Intergenic
1121901761 14:97699098-97699120 CGCATTCCAGTCCTCAAATATGG + Intergenic
1121939780 14:98059203-98059225 CCCATTGATGGCTTGAAATCAGG - Intergenic
1124241897 15:28035386-28035408 TCCATTCCTCTCTGCAAATAGGG + Intronic
1125332459 15:38595496-38595518 CCCATACATTTCTTGAAATTAGG + Intergenic
1128723305 15:69969100-69969122 CTCATTCTTGTTTTCAAAAAAGG + Intergenic
1130972908 15:88748372-88748394 TCCACTCATGTCACCAAATATGG + Intergenic
1135702228 16:24642440-24642462 CCCATGCAAGGCATCAAATAGGG + Intergenic
1135773270 16:25233952-25233974 CACATTGGTGTCTTCAAAGAGGG + Intergenic
1135832244 16:25785918-25785940 CACCATTATGTCTTCAAATATGG - Intronic
1136017770 16:27415640-27415662 CTCATTCTTCTCATCAAATAAGG + Intronic
1137854847 16:51784272-51784294 GCCATTCATGATTTCAAAGATGG + Intergenic
1139769734 16:69264289-69264311 ACCACTCATGTCTTCAGGTAGGG - Intronic
1140584051 16:76267311-76267333 CCAATCTATGTCTTCAAATTTGG - Intergenic
1143875799 17:9989932-9989954 CCCAGTCAAGCCTTCAAATGAGG - Intronic
1151876614 17:76870624-76870646 CCCAATCCTGCCTTCAGATAAGG - Intronic
1155671164 18:28372743-28372765 TACATTCAAGTCTTCTAATAAGG - Intergenic
1159157906 18:64608129-64608151 CCCATTCCTCTCATCAAACAAGG - Intergenic
1159320804 18:66845491-66845513 CGCATTCCTCTCATCAAATAAGG - Intergenic
1166198518 19:41221528-41221550 GCCATTCTGGTCTTCAGATAAGG + Intronic
925629450 2:5875159-5875181 CCAATTCTTATTTTCAAATATGG - Intergenic
926646968 2:15300684-15300706 AGAATTCCTGTCTTCAAATAAGG + Intronic
926962524 2:18374154-18374176 CTCATTCCTCTCATCAAATAAGG + Intergenic
933484021 2:82896127-82896149 CCCATTGATGTTTTTAAAGAAGG - Intergenic
936607321 2:113971624-113971646 CCCAAGCATGTTCTCAAATACGG + Intergenic
936828531 2:116611152-116611174 CCCATCCATGCCTTCAAAAATGG - Intergenic
939420287 2:141958432-141958454 CCCATTCTTGTTTGCAAAGATGG + Intronic
943149211 2:184090111-184090133 TCCATTTGTGTCTTAAAATAGGG + Intergenic
944411765 2:199451821-199451843 CACACTGATGTATTCAAATAGGG - Intronic
944454747 2:199881557-199881579 CTCATTCATGTGTTCAATCAGGG + Intergenic
944722143 2:202434518-202434540 CTCATTCCTGTCATCAAACAAGG + Intronic
946093201 2:217248807-217248829 TCTTTCCATGTCTTCAAATAGGG + Intergenic
1170771351 20:19335600-19335622 ACCATTACTATCTTCAAATATGG - Intronic
1175444554 20:59011038-59011060 CCTATTCATTTCTAAAAATAAGG + Intergenic
1180700491 22:17778893-17778915 CTCATTCATATCCTCAAACACGG + Intergenic
1184306946 22:43610040-43610062 CACATTCAGGTCTTGAAATCTGG - Intronic
1185264233 22:49890601-49890623 CTCATTCTTCTCATCAAATAAGG - Intergenic
951207627 3:19941258-19941280 AGCATTCAGTTCTTCAAATAGGG + Intronic
951330214 3:21358297-21358319 CCCTTTCTAGTCTGCAAATATGG - Intergenic
951941817 3:28087686-28087708 CTCATTTATGTGTGCAAATAGGG - Intergenic
954502618 3:51033174-51033196 CTCATTCGTCTCATCAAATAAGG - Intronic
957626737 3:82662195-82662217 CTCATTCCTCTCATCAAATAAGG - Intergenic
961440914 3:126952710-126952732 CACATTCATCTCTCAAAATATGG - Intronic
962045313 3:131752623-131752645 CCCATTCATCTCACTAAATATGG - Intronic
962420403 3:135223628-135223650 CTCTATCATGGCTTCAAATACGG - Intronic
962860591 3:139396884-139396906 CCAATGCATGTATTAAAATATGG + Intergenic
963028153 3:140940828-140940850 CTCATTCCTCTCTTTAAATAAGG + Intergenic
965567279 3:170133537-170133559 GCCATTCATATCTTCTATTAAGG - Intronic
966170414 3:177073968-177073990 CCCATTCAGGACTCCAAACATGG + Intronic
967014674 3:185471097-185471119 CTCATTCATCTCATCAAACAAGG - Intronic
968583961 4:1407326-1407348 CCCTTTCACGTCGTCAAATTAGG + Intergenic
968593085 4:1469350-1469372 CCCAGCCATGTCATCAAACAGGG - Intergenic
970012527 4:11475388-11475410 CTCATTCATTCCTTCAAATACGG - Intergenic
970486854 4:16533330-16533352 ACCATTCATGTCTGCAAAAATGG + Intronic
973850178 4:54954358-54954380 TCAATTCATCTCTGCAAATATGG - Intergenic
974886785 4:67829008-67829030 CTCATTCCTCTCATCAAATAAGG + Intronic
975289214 4:72657304-72657326 TCCACTCATGTCACCAAATATGG + Intergenic
976901836 4:90187109-90187131 CAGAGTCATGTCTTTAAATAAGG - Intronic
978359727 4:107917684-107917706 CCCTTTCATGTCATAAAATGGGG - Intergenic
979126473 4:116979448-116979470 CCCATTCCTGTCTGAAATTAAGG + Intergenic
979754904 4:124328313-124328335 CCCATTCACGTCTCCCCATATGG - Intergenic
981024557 4:140064148-140064170 CCCATTTATGTGATTAAATATGG - Intronic
981460323 4:145006407-145006429 TGAATACATGTCTTCAAATAAGG + Intronic
981613545 4:146622248-146622270 CCCATTGATGCTTTCCAATATGG - Intergenic
984636791 4:182119534-182119556 CCCATTTATCTCTCCAAATTTGG + Intergenic
986178013 5:5368321-5368343 CCCATTCTTGGCTTCAACTTTGG + Intergenic
986878398 5:12139387-12139409 CCTATTCATCTCTTCAGCTAAGG - Intergenic
988094814 5:26591976-26591998 CCAATACATGTCTAAAAATAAGG + Intergenic
991999551 5:72422266-72422288 CTCATTCATCTCATCAAACATGG - Intergenic
993935391 5:93994354-93994376 TTCATATATGTCTTCAAATATGG - Intronic
993960707 5:94294088-94294110 CCAATCTATGTCTTCAAATTGGG + Intronic
994845980 5:104988902-104988924 CCCATTGATATCTTCCAAAAGGG - Intergenic
994868089 5:105305079-105305101 CTCATTCATGTTTTCACAAATGG + Intergenic
996097334 5:119412748-119412770 CCTATTCAAGTTTTCAAAAAAGG - Intergenic
996598997 5:125239453-125239475 CTCATTCCTGTCATCAAACAAGG - Intergenic
996947915 5:129093067-129093089 CCCTTTCATGTTTTTAAATTAGG - Intergenic
997031982 5:130140922-130140944 AGCATTCAATTCTTCAAATAAGG - Intronic
997392369 5:133527706-133527728 CACCTTCATGTTTCCAAATAAGG - Intronic
1004800084 6:19136495-19136517 CACATTCATGTGTTTCAATAGGG - Intergenic
1007188677 6:39995210-39995232 CCCATTTGTGGCTTCATATAGGG + Intergenic
1008465551 6:51826305-51826327 CCCATTCATGTCTTCAAATAAGG + Intronic
1009767981 6:68106799-68106821 CTCATTCCTTTCGTCAAATAAGG + Intergenic
1009812465 6:68686160-68686182 CTCATTACTGTCATCAAATAAGG - Intronic
1010267607 6:73884596-73884618 CCAATTTATGTCATCAACTAGGG - Intergenic
1010847934 6:80734149-80734171 TCCATTCACATCTTCAAAAATGG - Intergenic
1011349326 6:86405154-86405176 CCAATTCATGGGTACAAATAAGG - Intergenic
1014125707 6:117774729-117774751 ACCATTTCCGTCTTCAAATATGG + Intergenic
1014161153 6:118170170-118170192 CCCATTCATCTCTTACTATATGG + Intronic
1015808708 6:137140189-137140211 CCCATTCATTACTGCAAAGAGGG + Intergenic
1016588131 6:145712759-145712781 CTCATTCATCTCATCAAACAAGG + Intronic
1017457175 6:154612066-154612088 CCCAGAAATGTCTACAAATAAGG + Intergenic
1018089460 6:160333198-160333220 CCCAGTCATGTCCTCAAAATCGG - Intergenic
1024341867 7:48273106-48273128 CCGTTTCATGGCTTCAAATGTGG + Exonic
1032450093 7:132023179-132023201 ACCATATATGTCTTCAAATCTGG - Intergenic
1033706399 7:143889861-143889883 CCCATTCCTCTCATCAACTAAGG + Intronic
1034402898 7:150877542-150877564 ACCATTCTTGTCTTCAATTATGG - Intergenic
1036342541 8:7929139-7929161 CACTTTCATATCTTGAAATAAGG + Intronic
1037059851 8:14494036-14494058 CCCATTCATCTCTTAAAAACAGG + Intronic
1037362833 8:18092002-18092024 CCCATTCCTCTCATCAAACAAGG - Intergenic
1039003059 8:33003086-33003108 CATTTTCATGTCTTAAAATAAGG + Intergenic
1039800884 8:40953462-40953484 CCCAGCCATGTCTTCAAGGAAGG + Intergenic
1040823184 8:51588160-51588182 CTCTTTTATTTCTTCAAATATGG - Intronic
1041309377 8:56499030-56499052 CCCATTCCTCTCATCAAACAAGG - Intergenic
1043049122 8:75362312-75362334 TCCATACATGTCACCAAATAGGG + Intergenic
1043576337 8:81662655-81662677 CCATGTCATGTCATCAAATAAGG + Intronic
1043698304 8:83250734-83250756 GCCATTCAGGTCTTCTAATTTGG - Intergenic
1045413878 8:101947382-101947404 CCCATTTCTCTCATCAAATAAGG + Intronic
1046079140 8:109349945-109349967 TCCATTCATGTTTTCACAAATGG + Intergenic
1047001168 8:120574055-120574077 TTCATTCATGTTGTCAAATATGG - Intronic
1051661588 9:19431984-19432006 CTCATTCATGACTTCAATTTAGG - Intronic
1051954435 9:22673647-22673669 CCCATTCCTGTCTTGGAATTAGG + Intergenic
1052284640 9:26770938-26770960 CTCATTCCTCTCATCAAATAAGG - Intergenic
1056925390 9:90830135-90830157 CCCATGTATGCCTGCAAATATGG + Intronic
1057326814 9:94072462-94072484 AACAATCATGTCTGCAAATAAGG + Intronic
1188911738 X:35857115-35857137 ACTATTGATGTCTTCAAATGTGG - Intergenic
1194076646 X:89402251-89402273 TCCTTTCATTTCTTCAAAGAGGG + Intergenic
1194190285 X:90826793-90826815 CCAATTCATGTCTTCTTTTAGGG + Intergenic
1195277096 X:103292426-103292448 CCCTTTCGTGTATTCAAAGAGGG - Intergenic
1195525324 X:105882332-105882354 TCCTTTCATGTGTTCAAGTATGG - Intronic
1195897540 X:109762271-109762293 CTCATTCCTCTCATCAAATAAGG - Intergenic
1196239393 X:113324155-113324177 CTCATTCTTGTCATCAAACAAGG - Intergenic
1197949611 X:131880255-131880277 CTCATTCATTTGTTCAATTATGG - Intergenic
1198530361 X:137546138-137546160 CCCATCTATATCTTCAAATCTGG - Intergenic
1198668560 X:139052541-139052563 CTCATTCATCTCATCAAACAAGG - Intronic
1199740345 X:150729715-150729737 CCCACTTATGTTTTCAAAGAAGG - Intronic
1200429288 Y:3057774-3057796 TCCTTTCATTTCTTCAAAGAGGG + Intergenic
1200536880 Y:4408894-4408916 CCAATTCATGTCTTCTTTTAGGG + Intergenic
1202046797 Y:20743684-20743706 CGCATTCATCTCATCAAACAAGG - Intergenic