ID: 1008466976

View in Genome Browser
Species Human (GRCh38)
Location 6:51842242-51842264
Sequence GCATCTCTGCTCCATGAGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008466970_1008466976 2 Left 1008466970 6:51842217-51842239 CCTCACACAATGTCCCAGCTCGG 0: 1
1: 0
2: 0
3: 22
4: 229
Right 1008466976 6:51842242-51842264 GCATCTCTGCTCCATGAGTGGGG No data
1008466967_1008466976 30 Left 1008466967 6:51842189-51842211 CCTTACAGGCAGACCTTCTCAGC 0: 1
1: 0
2: 1
3: 5
4: 117
Right 1008466976 6:51842242-51842264 GCATCTCTGCTCCATGAGTGGGG No data
1008466968_1008466976 17 Left 1008466968 6:51842202-51842224 CCTTCTCAGCTGCCGCCTCACAC 0: 1
1: 0
2: 3
3: 20
4: 232
Right 1008466976 6:51842242-51842264 GCATCTCTGCTCCATGAGTGGGG No data
1008466969_1008466976 5 Left 1008466969 6:51842214-51842236 CCGCCTCACACAATGTCCCAGCT 0: 1
1: 0
2: 0
3: 19
4: 229
Right 1008466976 6:51842242-51842264 GCATCTCTGCTCCATGAGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008466976 Original CRISPR GCATCTCTGCTCCATGAGTG GGG Intronic
No off target data available for this crispr