ID: 1008467575

View in Genome Browser
Species Human (GRCh38)
Location 6:51847774-51847796
Sequence CTGAGGCAACTCACCTATCT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 467
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 439}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008467575_1008467581 19 Left 1008467575 6:51847774-51847796 CCCAGATAGGTGAGTTGCCTCAG 0: 1
1: 0
2: 1
3: 26
4: 439
Right 1008467581 6:51847816-51847838 TCACAGCCTTGGTTCTGACCTGG 0: 1
1: 0
2: 0
3: 31
4: 176
1008467575_1008467583 25 Left 1008467575 6:51847774-51847796 CCCAGATAGGTGAGTTGCCTCAG 0: 1
1: 0
2: 1
3: 26
4: 439
Right 1008467583 6:51847822-51847844 CCTTGGTTCTGACCTGGTGATGG 0: 1
1: 0
2: 4
3: 13
4: 213
1008467575_1008467579 8 Left 1008467575 6:51847774-51847796 CCCAGATAGGTGAGTTGCCTCAG 0: 1
1: 0
2: 1
3: 26
4: 439
Right 1008467579 6:51847805-51847827 TGAAGAACCAGTCACAGCCTTGG 0: 1
1: 0
2: 1
3: 13
4: 220

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008467575 Original CRISPR CTGAGGCAACTCACCTATCT GGG (reversed) Exonic
901286312 1:8081848-8081870 CTCAGGCAATTCACCTGCCTCGG + Intergenic
901699026 1:11033409-11033431 CTCAGGCAACCCACCTGCCTCGG - Intronic
902346943 1:15825206-15825228 CTCAGGCAATCCACCCATCTCGG + Intergenic
903093028 1:20940087-20940109 CTCAGGCAATCCACCTACCTCGG + Intronic
903699610 1:25236958-25236980 CTCAGGCAAATCACCCACCTCGG - Intergenic
903923357 1:26816940-26816962 CTCAAGCAACTCACCCACCTTGG - Intergenic
903932443 1:26870861-26870883 CTCAGGCAACTCGCCTACCTCGG + Intergenic
903974691 1:27141780-27141802 CGGGGCCAACTCACCTAACTGGG - Intronic
905013610 1:34762676-34762698 CAGAGGGGACTCACCTATCCGGG - Exonic
905438802 1:37979620-37979642 CTCAAGCAATTCACCTATCTTGG - Intronic
905887031 1:41496920-41496942 CTGAAGCCACTCCCCTCTCTGGG + Intergenic
905996813 1:42388436-42388458 CTCAAGTAATTCACCTATCTCGG + Intronic
906101430 1:43266202-43266224 CAAAGGACACTCACCTATCTAGG + Intronic
906941060 1:50255807-50255829 CTGAGGCCACACACCTACCCTGG - Intergenic
908430709 1:64054185-64054207 CTCAAGCAACCCACCTACCTTGG + Intronic
909156890 1:72089606-72089628 CTGGGTCAAATCACATATCTTGG + Intronic
910162912 1:84293134-84293156 CTCAGGCAAATCACCTGCCTTGG - Intergenic
911262062 1:95698539-95698561 CGGAGGCAATTCACCTATTCTGG - Intergenic
913593526 1:120352094-120352116 CTCAGGCAATCCACGTATCTTGG + Intergenic
914051150 1:144133472-144133494 CTGAGGTAATCCACCCATCTTGG + Intergenic
914093729 1:144526890-144526912 CTCAGGCAATCCACCTATCTTGG - Intergenic
914128031 1:144831970-144831992 CTGAGGTAATCCACCCATCTTGG - Intergenic
914304796 1:146407011-146407033 CTCAGGCAATCCACCTATCTTGG + Intergenic
914597259 1:149165818-149165840 CTCAGGCAATCCACCTATCTTGG - Intergenic
914766004 1:150638430-150638452 CTTAGGCAATCCACCCATCTCGG - Intergenic
915378513 1:155419668-155419690 ATGAGGCAAATCAAATATCTGGG - Intronic
916177055 1:162050936-162050958 CTCAGGCAATCCACCCATCTCGG - Intergenic
916322370 1:163519492-163519514 CTCAGGCAATTCACCCACCTTGG - Intergenic
916859769 1:168790507-168790529 CTCAGGCAATCCACCCATCTTGG - Intergenic
917340635 1:173974047-173974069 CAGAGGCAATCCACCCATCTTGG + Intronic
917918572 1:179729512-179729534 CAGAGGAAAGTCACCTAGCTGGG + Intergenic
918270078 1:182889827-182889849 CTCAGGCAATTCACCTGCCTCGG + Intergenic
918620160 1:186594653-186594675 CTCAAGCAATTCTCCTATCTTGG - Intergenic
919019391 1:192084688-192084710 CTCAGGCAATCCACCTACCTTGG + Intergenic
920762676 1:208800599-208800621 CTCAGGTAACCCACCTACCTAGG - Intergenic
921065794 1:211621175-211621197 CCCAGGCAACTCATCCATCTGGG + Intergenic
921616624 1:217275702-217275724 CTGGGGGAACTCAACTAACTTGG + Intergenic
922158720 1:223061800-223061822 CTCAGGCAATTCACCTGCCTCGG + Intergenic
922541321 1:226422465-226422487 CTGAAGCAATCCACCTATCTCGG + Intergenic
922944134 1:229496238-229496260 CTCAGGCAATCCACCTGTCTCGG - Intronic
923587671 1:235289488-235289510 CTCAAGCACCTCACCTACCTCGG - Intronic
924527959 1:244868820-244868842 CTCAGGCAATCCACCCATCTCGG + Intergenic
924672695 1:246146102-246146124 CTCAGGGAGCTTACCTATCTGGG + Intronic
1063087723 10:2834615-2834637 CTGAGTCAACTCGTCTATCCCGG - Intergenic
1063515874 10:6694746-6694768 GTGAGAAAACTCACCTACCTTGG + Intergenic
1063771483 10:9207732-9207754 CTCAGGCAACCCACCTGCCTCGG + Intergenic
1064207404 10:13335744-13335766 CTCAGGTAATCCACCTATCTCGG - Intronic
1064270697 10:13863346-13863368 CTGAGGCAATCCACCTGCCTCGG - Intronic
1064403767 10:15042384-15042406 CTCAGGCAATCCACCTGTCTTGG + Intronic
1064828114 10:19429334-19429356 CTCAGGCAATCCACCTGTCTCGG - Intronic
1064940929 10:20734834-20734856 CTCAGGCAATCCACCCATCTCGG - Intergenic
1065517788 10:26542387-26542409 CTCAGGCAATCCACCTACCTTGG + Intronic
1065692247 10:28346745-28346767 CTCAGGCAATCCACCTGTCTTGG - Intergenic
1065790102 10:29252819-29252841 CTGAGGCAAGTCCTCTGTCTGGG + Intergenic
1066174195 10:32886853-32886875 CTTAGGCAATCCACCTGTCTTGG - Intergenic
1068545350 10:58338078-58338100 CTCAGGCAATCCACCTACCTCGG + Intronic
1068668748 10:59703351-59703373 CTGAAGCAATTCTCCTATCATGG + Intronic
1069780353 10:70951530-70951552 GAGAGGCAACTCACCTGTATGGG - Intergenic
1070098996 10:73367347-73367369 CTGAGGCAATCCACCCACCTTGG - Intergenic
1070243456 10:74707267-74707289 CTCAAGCAATTCACCCATCTTGG + Intronic
1070246514 10:74737416-74737438 CTCAAGCAATTCACCTGTCTCGG - Intergenic
1070318552 10:75337088-75337110 CTCAAGCAATTCACCTGTCTTGG - Intergenic
1070466980 10:76733381-76733403 CTCAGGCAATCCACCTGTCTCGG + Intergenic
1071163344 10:82777909-82777931 CTGAGGCATCTCACCTCCATGGG - Intronic
1071222506 10:83485761-83485783 CTCAAGCAATTCTCCTATCTTGG + Intergenic
1071882334 10:89912874-89912896 CTCAGGCAACCCACCTGCCTTGG - Intergenic
1072410585 10:95198415-95198437 CTCAGGCAATTCACCTGCCTCGG - Intronic
1072917713 10:99549610-99549632 CTCAGGCAATTCTCCTGTCTCGG + Intergenic
1073387642 10:103140150-103140172 CTCAAGCAACCCTCCTATCTCGG + Intronic
1073726956 10:106243852-106243874 CGGAGGCAACCCACATGTCTTGG - Intergenic
1074309725 10:112312030-112312052 CTCAGGCAATCCACCCATCTCGG + Intergenic
1074394777 10:113088721-113088743 CTCAGGCAATCCTCCTATCTCGG - Intronic
1074963016 10:118464716-118464738 CTCAGGCAATCCACCTGTCTCGG - Intergenic
1075148636 10:119906040-119906062 CTGAAGCAACCCACCCACCTTGG - Intronic
1075319090 10:121475401-121475423 CTGAGGCATCTTAGCTACCTTGG + Intergenic
1077656393 11:4023095-4023117 CTCAGGCAATCCACCCATCTCGG - Intronic
1078365314 11:10701574-10701596 CTCAGGCAACCCACCCACCTCGG + Intergenic
1078481494 11:11680074-11680096 CTCAGGCAATTCACCTGCCTTGG - Intergenic
1079118343 11:17655369-17655391 CTGAGGCAACTGAAATATGTGGG + Intergenic
1079893772 11:26092858-26092880 CTGAGGCAATTCACCTGCCTCGG + Intergenic
1080219112 11:29879732-29879754 CTGCAGCAACTCTCCTATCCGGG + Intergenic
1080225930 11:29960108-29960130 CTGAAACAACTCATCTTTCTTGG - Intergenic
1080231745 11:30023977-30023999 CTAAGACAACTCACCTTTGTAGG + Intergenic
1080480114 11:32638912-32638934 CTCAGGCAACCCACCTGCCTTGG - Intronic
1081496155 11:43612637-43612659 CTCAGGCAATTCACCCACCTCGG + Intronic
1083314602 11:61806627-61806649 CTGAGGCAGCTCCCCTGTGTTGG + Intronic
1083358455 11:62086134-62086156 CTCAAGCAATTCACCCATCTCGG + Intergenic
1083547728 11:63561408-63561430 CTCAGGCAATCCACCCATCTCGG - Intronic
1084391798 11:68882200-68882222 CTGAAGCAATCCACCCATCTCGG + Intergenic
1085263514 11:75222880-75222902 CTCAGGCAACTCACCCACTTCGG - Intergenic
1087168247 11:95025301-95025323 CTGAGGAAACTCACAGAGCTGGG + Exonic
1088620757 11:111680659-111680681 ATGAGGGAACTCAGCTGTCTGGG + Intronic
1089129783 11:116202714-116202736 ATGAGGCATTTCACCAATCTTGG - Intergenic
1090504519 11:127297206-127297228 CTCAGGCAATCCACCTGTCTTGG - Intergenic
1092559123 12:9591301-9591323 ATGAAGCAACTAACTTATCTTGG - Intergenic
1093372855 12:18385797-18385819 CTCAGGTAATCCACCTATCTCGG + Intronic
1095055344 12:37591566-37591588 CTGAGGTGATCCACCTATCTTGG - Intergenic
1096083722 12:48851236-48851258 CTCAGGCAATCCACCTGTCTCGG - Intronic
1096140969 12:49242222-49242244 CTCAAGCAATTCACCTGTCTTGG + Intronic
1100586805 12:95987958-95987980 CTCAGGCAATCCACCTGTCTCGG + Intronic
1101145655 12:101838318-101838340 CTCAGGCAATCCACCCATCTCGG + Intergenic
1102077359 12:110070328-110070350 CTCAGGCAATCCTCCTATCTTGG - Intronic
1102138399 12:110594346-110594368 CTCAGGCAATCCACCTGTCTTGG + Intergenic
1103348968 12:120269874-120269896 CTGAGGTAATCCACCCATCTTGG - Intergenic
1103549506 12:121726669-121726691 CTCAGGCAATCCACCTACCTTGG - Intronic
1103983967 12:124755042-124755064 CTGAGGCCACAGACCTCTCTGGG + Intergenic
1104346397 12:128003492-128003514 CTCAGGTGACCCACCTATCTCGG - Intergenic
1105697589 13:22904013-22904035 CTGCAGCAACTCTCCTATCAGGG + Intergenic
1106659865 13:31787872-31787894 CTCAGGCAATTCACCTGCCTTGG + Intronic
1109300632 13:60586738-60586760 CTCAAGCAATCCACCTATCTTGG - Intergenic
1109444140 13:62411184-62411206 CAGATTCAACTCACCTTTCTTGG - Intergenic
1109490501 13:63092102-63092124 CTGTGCCAAATCACATATCTGGG + Intergenic
1110746466 13:79059309-79059331 CTCAGGCAATCCACCCATCTTGG + Intergenic
1113232010 13:108222071-108222093 CTCAGGCAATCCACCTGTCTTGG + Intronic
1114208443 14:20595630-20595652 CTCAAGCAAGTCACCCATCTTGG + Intronic
1114357745 14:21931247-21931269 CTAAAGCAATTCACCTACCTCGG + Intergenic
1114907797 14:27151952-27151974 CTGAGCCAACCCACCCATCTGGG - Intergenic
1115603550 14:34978593-34978615 CTTAGGCAATTCACCTACCTCGG + Intergenic
1116704073 14:48274674-48274696 CTCAGGCAATTCACCTGCCTTGG - Intergenic
1116898735 14:50341543-50341565 CTGAAGCAAACCACCTACCTCGG - Intronic
1117355897 14:54923668-54923690 CTCAGGCAACTCGCCTGCCTTGG - Intergenic
1117375904 14:55118030-55118052 CTGAGGCAACTCTTCTAGGTTGG + Intergenic
1117940173 14:60955426-60955448 CTCAGGTGACTCACCTGTCTCGG - Intronic
1118416165 14:65538684-65538706 CTCAGGCAATCCACCTACCTCGG - Intronic
1118699017 14:68414786-68414808 CTGAGGCGATTCACCCACCTTGG - Intronic
1119454232 14:74740766-74740788 CTGAGGCGATTCACCTGCCTCGG - Intergenic
1119674688 14:76544928-76544950 CTCAGGCAATCCACCCATCTCGG - Intergenic
1122001518 14:98660027-98660049 CTCAGGCAATCCACCTGTCTTGG + Intergenic
1122318056 14:100837240-100837262 CTGAGGCCACTTTCCTTTCTGGG + Intergenic
1122927459 14:104912414-104912436 CTGAGGCGATCCACCCATCTTGG - Intergenic
1124448816 15:29765655-29765677 CTCAGGCAATTCACCTGCCTCGG - Intronic
1124654470 15:31497481-31497503 CTCAGGCAACCCACCCACCTCGG + Intronic
1125842154 15:42813286-42813308 CTCAAGCAATTCACCTGTCTTGG - Intronic
1125977187 15:43965034-43965056 CTGAGGGAACTCACCTAGTATGG + Intronic
1126038201 15:44566934-44566956 CTCAGGCAATCCACCTACCTTGG + Intronic
1126587145 15:50300038-50300060 CTCAAGCAATCCACCTATCTTGG + Intronic
1126780333 15:52134073-52134095 CTTAGGCAAGTCACCTCCCTGGG + Intronic
1127346981 15:58110797-58110819 CTCAAGCAATCCACCTATCTTGG + Intronic
1127882994 15:63174498-63174520 CTGAGGCAATCCACTCATCTCGG - Intergenic
1128000229 15:64184441-64184463 CTCAGGCAATCCACCTGTCTCGG - Intronic
1129484727 15:75859034-75859056 ATAAGGCAACTCACTTAACTCGG - Intronic
1131219174 15:90566942-90566964 CTCAGGTAACTCACCCTTCTTGG + Intronic
1132066667 15:98736843-98736865 CTCAGGCAATCCGCCTATCTCGG + Intronic
1132198730 15:99933121-99933143 TTGAGGCAAATCACCTCACTTGG + Intergenic
1132545684 16:532004-532026 CTCAGGCAACCCACCTGCCTCGG - Intronic
1134018160 16:10903722-10903744 CTGGGGCACCTCACCTACATTGG - Exonic
1134091347 16:11393225-11393247 CTCAAGCAATTCACCCATCTCGG + Intronic
1134295185 16:12939315-12939337 CTCAGGCAATCCACCCATCTTGG + Intronic
1135332651 16:21573615-21573637 CTCAGGCAATCCACCTACCTTGG - Intergenic
1135534404 16:23281956-23281978 CTCAAGCAACTCACCCACCTCGG - Intronic
1135611236 16:23869255-23869277 CTGAGGCAACAGCCCTTTCTTGG - Intronic
1135623201 16:23973902-23973924 CTCAAGCAATTCACCTTTCTTGG + Intronic
1135706313 16:24678074-24678096 CTCAGGCAATTCACCCACCTCGG - Intergenic
1135912107 16:26570811-26570833 CTCAGGCAATTCACCTGTCTCGG - Intergenic
1137658416 16:50181536-50181558 CTCAAGCAACTCACCTGCCTCGG + Intronic
1138089476 16:54162546-54162568 CTCAGGCAATTCACCCACCTCGG + Intergenic
1138359733 16:56417927-56417949 CTCAAGCAACTCACCCACCTTGG - Intronic
1138570393 16:57868075-57868097 CTCAAGCAATTCACCCATCTTGG + Intergenic
1138612083 16:58133334-58133356 CTCAGGTAATTCACCCATCTTGG + Intergenic
1140379761 16:74475946-74475968 CTCAGGCAATCCACCTGTCTTGG - Intronic
1143475452 17:7200777-7200799 CTCAGGTGACTCACCCATCTCGG + Intronic
1143724588 17:8836533-8836555 CTGGGGCCACTCACCTCTCCTGG + Exonic
1144956698 17:19022214-19022236 CTGTGGCAAATCACTTCTCTTGG - Intronic
1146071525 17:29686600-29686622 CTCAGGCAATCCACCTGTCTTGG + Intronic
1147173704 17:38637548-38637570 CTCAGGCAATCCACCTGTCTTGG - Intergenic
1148214446 17:45826740-45826762 CTCAGGCAATCCACCTGTCTCGG - Intronic
1148653209 17:49264448-49264470 CTGAGGTAATCCACCCATCTCGG - Intergenic
1148739897 17:49886866-49886888 CTCAGGCAATCCACCCATCTCGG - Intergenic
1148948067 17:51283100-51283122 CTCAGGCAACCCACCTGCCTCGG + Intronic
1150821297 17:68436339-68436361 CTGAGCCAACCCACCTGCCTTGG - Intronic
1151238826 17:72741966-72741988 CTCAAGCAATTCACCTACCTCGG - Intronic
1152066811 17:78116650-78116672 CTGAGGCAATCCACCCACCTTGG - Intronic
1153016930 18:591297-591319 CTCAAGCAATTCACCTACCTTGG + Intergenic
1153281249 18:3416284-3416306 CTCAGGCAATCCACCTACCTTGG - Intronic
1155141031 18:23044589-23044611 CTCAGGCGACCCACCTGTCTTGG - Intergenic
1155237959 18:23840479-23840501 CTCAGGCAATTCTCCCATCTCGG + Intronic
1155338803 18:24793448-24793470 ATGAGGCAACACACACATCTGGG - Intergenic
1156535418 18:37859956-37859978 CTGACTCCATTCACCTATCTTGG - Intergenic
1156552992 18:38037936-38037958 CTCAGGCAATCCACCCATCTTGG + Intergenic
1157357809 18:46951695-46951717 CTGAGCCAAATCACCAATCAAGG - Intronic
1158609002 18:58921870-58921892 CTCAGGCAATTCACCTGTCTCGG - Intronic
1158715623 18:59876843-59876865 CTCAGGCAACCCACCTGCCTCGG - Intergenic
1161511448 19:4674580-4674602 CTGATGCAATCCACCCATCTTGG + Intergenic
1161700988 19:5795241-5795263 CTCAGGCAATCCACCCATCTTGG + Intergenic
1162288512 19:9760056-9760078 CTCAGGTAAGCCACCTATCTAGG - Intronic
1163480129 19:17550431-17550453 CTCAAGCAATCCACCTATCTTGG - Intronic
1163960492 19:20685480-20685502 CTCAGGCAATTCACCCACCTCGG + Intronic
1163961447 19:20698733-20698755 CTTAGGCAATCCACCTGTCTTGG - Intronic
1164075507 19:21813994-21814016 CTGAAGCAATCCACCTGTCTTGG + Intronic
1164123902 19:22292672-22292694 CTCAGGCAATTCACCTGCCTCGG + Intronic
1165812429 19:38619526-38619548 CTCAGGCGACCCACCTACCTCGG - Intronic
1166087289 19:40485372-40485394 CTCAGGCAATCCACCTACCTTGG + Intronic
1166174234 19:41054506-41054528 CTCAGGTAACTCACCTGCCTTGG - Intergenic
1166553093 19:43679824-43679846 CTCAGGCAATCCACCCATCTTGG - Intergenic
1166855254 19:45780055-45780077 CTCAGGCATCTCACCTCTATGGG - Exonic
1167585879 19:50375557-50375579 CTCAGGCAATCCACCTACCTCGG - Intronic
1167862469 19:52296946-52296968 CTGGAGCAACTCAGCTGTCTCGG - Intergenic
1167868160 19:52345013-52345035 CTCAGGCAATCCACCTACCTTGG + Intronic
1168087849 19:54061577-54061599 CTCAAGCAATTCTCCTATCTTGG - Intronic
1168537166 19:57180711-57180733 CTCAGGCAATCCACCTGTCTTGG - Intergenic
1202690557 1_KI270712v1_random:86112-86134 CTGAGGTAATCCACCCATCTTGG + Intergenic
925575234 2:5353199-5353221 CTCAGGCAACACACATATATTGG + Intergenic
925706987 2:6695145-6695167 CTCAGGCAATCCACCTGTCTTGG - Intergenic
930613252 2:53566455-53566477 CTTAGGCAATCCACCCATCTAGG - Intronic
930817111 2:55609446-55609468 CTCAAGCAGCCCACCTATCTTGG - Intronic
932464704 2:71910568-71910590 CTGAAGCAATCCACCTACCTTGG - Intergenic
932553702 2:72799003-72799025 CTCAAGCAATTCACCTACCTTGG - Intronic
932690910 2:73912932-73912954 CTCAGGCAATTCACCTGCCTCGG - Intronic
932730490 2:74218035-74218057 CTCAGGCAATTCACCTGCCTCGG + Exonic
933640936 2:84759272-84759294 CTCAGGCAATCCACCCATCTTGG - Intronic
933955856 2:87369892-87369914 CTGAGGTAATCCACCCATCTTGG - Intergenic
934240009 2:90261927-90261949 CTGAGGTAATCCACCCATCTTGG - Intergenic
934273182 2:91554827-91554849 CTGAGGTAATCCACCCATCTTGG + Intergenic
936431426 2:112467026-112467048 CTCAAGCAACCCACCCATCTTGG - Intergenic
937224445 2:120360199-120360221 CTCAGGCAAGTCTCCTCTCTGGG - Intergenic
937570958 2:123360814-123360836 TTGAGGCCACCCACCTTTCTTGG + Intergenic
937649579 2:124305030-124305052 CTCAAGCAACTCACCTGCCTTGG - Intronic
939626714 2:144485850-144485872 CTCAGGCAATCCACCTGTCTCGG + Intronic
939827883 2:147037068-147037090 CTGAGGCAATCCACCTGCCTCGG + Intergenic
940397740 2:153211374-153211396 CTCAGGCAATCCACCCATCTTGG + Intergenic
940949188 2:159652849-159652871 CTCAAGCAATTCTCCTATCTTGG + Intergenic
942137022 2:172936133-172936155 CTCAGGCAACCCACCCACCTCGG - Intronic
942287413 2:174434202-174434224 CTGAAGCAATTCACCTGCCTCGG + Exonic
942652657 2:178184578-178184600 CTCAGGCAATCCACCTACCTCGG + Intergenic
943935592 2:193911433-193911455 CTCAGGCAATCCACCCATCTTGG + Intergenic
944463410 2:199976030-199976052 CTGAAGCAATTCACCCACCTTGG + Intronic
944550183 2:200838484-200838506 CTCAGGCAACCCACCTGCCTCGG - Intergenic
944627267 2:201584053-201584075 CTGAAGCAATTCACCCACCTTGG - Intronic
945060099 2:205901201-205901223 CTCAGGCAATTCACCCACCTTGG + Intergenic
945428671 2:209738977-209738999 CTGAGGCATCTAGCCCATCTAGG + Intergenic
945946874 2:216003216-216003238 CTGAGGCAGGTCACATCTCTGGG - Intronic
946317056 2:218923372-218923394 CTCAGGCAATCCACCCATCTCGG + Intergenic
947673333 2:231956021-231956043 CTCAAGCAATTCACCCATCTTGG + Intergenic
1168785362 20:534793-534815 CTCAGGCAATCCACCCATCTCGG - Intronic
1169134056 20:3185768-3185790 CTCAAGCAATCCACCTATCTTGG - Intergenic
1169427226 20:5505928-5505950 CTCAGGCAATCCACCCATCTTGG + Intergenic
1170863658 20:20133301-20133323 CTGAGTCTACTCACATGTCTTGG + Intronic
1172579163 20:36033159-36033181 CTCAGGCAATCCACCTGTCTTGG + Intergenic
1174087981 20:48023311-48023333 CTCAAGCAATTCACCTACCTTGG - Intergenic
1174905722 20:54548468-54548490 CTCAAGCAACTCACCCACCTGGG + Intronic
1177170605 21:17651425-17651447 CTGAGGCAATCCACCCAACTAGG - Intergenic
1177837268 21:26198302-26198324 CTGATGCCACACAGCTATCTAGG - Intergenic
1178847795 21:36187832-36187854 CTGAAGCAATTCACCTGCCTCGG + Intronic
1179108889 21:38427951-38427973 CTAAAACAATTCACCTATCTTGG - Intronic
1180550861 22:16538435-16538457 CTGAGGTAATCCACCCATCTTGG - Intergenic
1180794650 22:18596400-18596422 CTCAAGCAATTCACCTACCTTGG - Intergenic
1181227089 22:21398921-21398943 CTCAAGCAATTCACCTACCTTGG + Intergenic
1181251561 22:21535922-21535944 CTCAAGCAATTCACCTACCTTGG - Intergenic
1181612785 22:24029941-24029963 CTGAGGCAAATCACCTAACGTGG + Intronic
1181665867 22:24396529-24396551 CTCAGGTAATTCACCCATCTCGG + Intronic
1182395731 22:30034418-30034440 CTGAGGCAACCCACCCGCCTCGG - Intergenic
1183042917 22:35196655-35196677 CTCAGGCAGCTCACCCATGTCGG - Intergenic
1184557748 22:45242124-45242146 CTCAGGCAATCCACCTACCTCGG - Intergenic
1185113540 22:48918250-48918272 CTCAAGCAACTCACCTACCTTGG - Intergenic
949219099 3:1608132-1608154 CTCAAGCAACTCACCTGCCTTGG + Intergenic
949952919 3:9243933-9243955 CTGAAGGAACTGACCTTTCTGGG + Intronic
950639872 3:14341911-14341933 CTCAAGCAATTCACCCATCTCGG + Intergenic
952717828 3:36498518-36498540 CTCAAGCAATTCTCCTATCTCGG - Intronic
952788501 3:37178558-37178580 CTTATGCAATTCACCTGTCTTGG - Intronic
953990662 3:47480741-47480763 CTCAGGCAACTCTCCCATCTTGG + Intergenic
954202894 3:49035303-49035325 CTGAAGCAATTCTCCTACCTCGG + Intronic
954346550 3:50004544-50004566 CTCAAGCAATTTACCTATCTCGG + Intronic
954511645 3:51130939-51130961 CTCAGGCAATTCACCCACCTTGG + Intronic
954992991 3:54857012-54857034 CTCAGGCAAGCCACCTGTCTTGG + Intronic
957597282 3:82283570-82283592 CTCAAGCAATTCACCTACCTCGG + Intergenic
958118302 3:89251282-89251304 CTGTGGGAAATCACCTACCTGGG + Intronic
958254593 3:91310943-91310965 CTCAGGCAATCCACCCATCTTGG - Intergenic
959140721 3:102483557-102483579 CTCAGGCAATCCACCCATCTCGG + Intergenic
961809182 3:129512056-129512078 CTTGGGCAAATCATCTATCTAGG + Intronic
962118431 3:132536328-132536350 CTCAAGCAACTCCCCTATCCAGG - Intronic
962738410 3:138345914-138345936 CTCAAGCAATCCACCTATCTGGG - Intergenic
964501805 3:157356130-157356152 CTCAAGCAACTCACCCACCTCGG + Intronic
964892381 3:161552487-161552509 CTGAGGCTATTCACCTCTCCCGG - Intergenic
964947446 3:162243564-162243586 CTCAGGCAATTCACCTGCCTTGG + Intergenic
965019473 3:163209812-163209834 CTCAGGCAATTCTCCTGTCTTGG - Intergenic
965340099 3:167479995-167480017 CTCAGGCAATTCACCTGCCTCGG - Intronic
965575336 3:170212252-170212274 CTCAGGCAATTCACCCACCTCGG + Intergenic
965690458 3:171351122-171351144 CTCAGGCAATTCACCCACCTCGG + Intronic
966599460 3:181760965-181760987 CTCAAGCAATTCACCCATCTTGG + Intergenic
967918969 3:194600354-194600376 CTCAGGCAATCCACCTGTCTCGG + Intronic
968147567 3:196312249-196312271 CTCAGGTAACTCACCTGTCTTGG + Intronic
968260351 3:197317371-197317393 CTCAGGCAAGTCACTTCTCTGGG - Intergenic
968386767 4:147628-147650 CTGAGGCAATTCACCTGCCTTGG - Intronic
968491135 4:891192-891214 CTGAGGCAATTCGCCTGCCTCGG + Intronic
969923341 4:10561132-10561154 CTGAAGCAATTCACCTACCTCGG + Intronic
970319164 4:14858763-14858785 CTAAGGCATGTCACCTCTCTAGG + Intergenic
970998612 4:22296621-22296643 CTGACTCAACTCAACTTTCTTGG + Intergenic
971135621 4:23864948-23864970 CTCAGGCAATTCACCCACCTTGG - Intronic
971842286 4:31868974-31868996 CTCAGGCAATCCACCTACCTCGG + Intergenic
972218849 4:36929813-36929835 CTGAGACAGCTCACCTGGCTTGG - Intergenic
973219532 4:47709523-47709545 CTCAAGCGACTCACCCATCTCGG + Intronic
975864491 4:78712951-78712973 CTCAAGCAATTCACCCATCTCGG + Intergenic
976153740 4:82120042-82120064 CTCAGGCAATACACCTGTCTTGG - Intergenic
976810194 4:89092108-89092130 CTGAAGCAATCCACCTACCTTGG - Intronic
978000482 4:103551915-103551937 CTCAGGCAATCCACCTACCTCGG - Intergenic
978146553 4:105379865-105379887 CTCAAGCAATCCACCTATCTTGG + Intronic
980230766 4:130043458-130043480 CTCAGGCAATCCACCTACCTCGG - Intergenic
980577624 4:134705376-134705398 CTCAGGCGATTCACCTGTCTCGG + Intergenic
980948991 4:139352899-139352921 CTCAGGCAATCCACCCATCTTGG + Intronic
981170624 4:141618955-141618977 CTCAGGCAATCCACCTGTCTTGG - Intergenic
981625289 4:146747909-146747931 CTGAGGCACCTTGCCTCTCTGGG + Intronic
983561341 4:169104666-169104688 CTCAGGCAATTCACCTGCCTCGG - Intronic
985909754 5:2869624-2869646 CTGAGGCACCTCAGCTTCCTCGG + Intergenic
988546210 5:32160309-32160331 CTCAGGCAATCCTCCTATCTTGG + Intronic
988681384 5:33487761-33487783 CTGAAGCAATTCACCTGCCTTGG - Intergenic
988824452 5:34921072-34921094 CTCAGACAATTCACCTACCTCGG + Intronic
989391111 5:40901930-40901952 CTCAGGCAATCCACCTGTCTTGG - Intergenic
989396808 5:40965874-40965896 CTCAGGCAATCCACCCATCTTGG + Intronic
990675074 5:58174966-58174988 CTCAAGCAATTCACCCATCTTGG + Intergenic
991363320 5:65843296-65843318 CTGCGGCAATCCTCCTATCTTGG + Intronic
991402910 5:66272911-66272933 CAGAGGCTAGTCACCTAGCTAGG + Intergenic
992325772 5:75657976-75657998 CTCAGGCAATCCTCCTATCTTGG - Intronic
992407920 5:76477099-76477121 CTGAGGCAATCTACCCATCTTGG - Intronic
996066039 5:119080380-119080402 CTCAGTCAACTCCCCTACCTTGG + Intronic
996110744 5:119563605-119563627 CTGGGGCCACTCACTGATCTAGG - Intronic
996321571 5:122222728-122222750 CTGAGGCACCCCACCTCTCTGGG + Intergenic
996722000 5:126639193-126639215 CTGAGGCAATCCACCCACCTCGG + Intergenic
996960428 5:129241834-129241856 CTGAGGCTACTTACCTAAATGGG - Intergenic
997328130 5:133039199-133039221 CTCAGGCTATCCACCTATCTCGG + Intergenic
998881484 5:146649681-146649703 CTGAAGCAATCCACCTACCTAGG + Intronic
999091626 5:148941197-148941219 ATGTGGCATCTCACCTCTCTGGG - Intronic
999198567 5:149799930-149799952 CTCAGGTAATTCACCCATCTCGG + Intronic
999203316 5:149831687-149831709 CAGATGCATCTCACCTCTCTGGG - Intronic
1000248104 5:159466641-159466663 CTCAAGCAATTCTCCTATCTAGG - Intergenic
1001846821 5:174929498-174929520 CTCAGGCAACCCACCTGGCTCGG + Intergenic
1002122242 5:177014285-177014307 CTCAGGCAATCCACCTACCTCGG + Intronic
1002293739 5:178216800-178216822 CTTAGGCAACTCACCCATCTTGG - Intronic
1002370882 5:178753181-178753203 ATGGGGAAACTGACCTATCTGGG + Intergenic
1002601841 5:180358086-180358108 CTCAGGCAATCCACCCATCTTGG + Intergenic
1003863795 6:10345589-10345611 CTCAAGCAACTCTCCTGTCTCGG + Intergenic
1003916165 6:10788223-10788245 CTCAAGCAACCCACCTACCTCGG + Intronic
1004741448 6:18465088-18465110 CTCATGTAACTCACATATCTGGG - Exonic
1006193902 6:32225743-32225765 CTTAGGCAATCCACCCATCTTGG + Intergenic
1006532647 6:34670144-34670166 CTCAGGCAACCCACCCACCTTGG + Intronic
1007067380 6:39005176-39005198 CTCAGGCAATTCACCCACCTTGG - Intronic
1007108665 6:39300355-39300377 CTCAGGCAATCCACCTACCTCGG + Intronic
1008467575 6:51847774-51847796 CTGAGGCAACTCACCTATCTGGG - Exonic
1008924156 6:56874810-56874832 CTGAGGAATCTCACCTTTCAAGG - Intronic
1010278938 6:74001631-74001653 CTGAAGCTACTCACCTGCCTTGG - Intergenic
1010597211 6:77778465-77778487 CTCAGGCAATTCACCTGCCTCGG - Intronic
1011342107 6:86327560-86327582 CTCAAGCAATTCACCTATCTTGG + Intergenic
1011893842 6:92199808-92199830 GTCAAGCAACCCACCTATCTTGG + Intergenic
1012393373 6:98768608-98768630 CTCAGGCAATTCACCTGCCTCGG - Intergenic
1013253168 6:108355172-108355194 CTCAGGCAATTCTCCCATCTTGG + Intronic
1013407396 6:109855742-109855764 CTGAGGCAATCCACCTGCCTTGG - Intergenic
1014714118 6:124843910-124843932 CTCAGGCAATCCACCTACCTCGG - Intergenic
1014865856 6:126529255-126529277 CTCAAGCAATTCACCTATCTCGG - Intergenic
1015497914 6:133900108-133900130 CTCAAGCAACTCACCTAGCTTGG + Intergenic
1016708328 6:147139978-147140000 CTCAGGCAATCCACCTACCTTGG - Intergenic
1016821841 6:148353934-148353956 CTCAAGCAACTCTCCTGTCTTGG - Intronic
1017452136 6:154564076-154564098 CCCATTCAACTCACCTATCTGGG + Intergenic
1019460117 7:1153709-1153731 CTCAGGCAATCCACCCATCTTGG - Intronic
1019465887 7:1188689-1188711 CTCAGGCAACTCTCCTGCCTTGG - Intergenic
1019987208 7:4666349-4666371 CTCAAGCAATCCACCTATCTCGG + Intergenic
1020649054 7:10853188-10853210 CTCAGGCAATCCACCTGTCTTGG - Intergenic
1021489007 7:21198002-21198024 CTCAGGCAATCCACCTGTCTCGG - Intergenic
1022563812 7:31376680-31376702 CTCAGGCAATCCACCTAACTCGG - Intergenic
1023002871 7:35829373-35829395 CTCAGGCAATCCACCTGTCTCGG + Intronic
1023014508 7:35953946-35953968 CTCAGGCAATCCACCTACCTCGG + Intergenic
1023059132 7:36312357-36312379 CTCAAGCAATTCTCCTATCTTGG + Intergenic
1024066487 7:45741060-45741082 CTCAGGCAATCCACCTACCTCGG - Intergenic
1024309591 7:47957727-47957749 CTCAAGCAACTCACCTGCCTTGG + Intronic
1024402768 7:48944181-48944203 CTCAGGCAATTCACCCATATCGG + Intergenic
1025063215 7:55829143-55829165 CTCAGGCAATCCACCTGTCTTGG - Intronic
1025158842 7:56635603-56635625 CTCAGGCAATCCACCTACCTTGG + Intergenic
1025298769 7:57799168-57799190 CTGAGGTGATCCACCTATCTCGG - Intergenic
1027336103 7:77152142-77152164 CTGAGGTACCTCATCTACCTAGG - Intronic
1029779684 7:102718960-102718982 CTGAGGTACCTCATCTACCTAGG + Intergenic
1030999400 7:116397415-116397437 CTGAGAGAAGTCACCTATCTTGG - Intronic
1033461226 7:141549329-141549351 CTTAGGCAATCCACCCATCTTGG + Intergenic
1034035093 7:147811329-147811351 CTCAGGCAATCCACCCATCTAGG + Intronic
1034228266 7:149499122-149499144 CTCAGGCAATCCACCCATCTTGG - Intergenic
1034378451 7:150667227-150667249 CTGAGGCATCTCAACTTTCAGGG - Intergenic
1036153662 8:6322097-6322119 CTCAGGCAATCCACCTGTCTCGG - Intergenic
1037640509 8:20737923-20737945 CTGAGGAAACTCAGCTAATTAGG + Intergenic
1038321420 8:26530909-26530931 CTGAGCCACCACACCTAACTGGG - Intronic
1038563216 8:28598272-28598294 CTCAGGCAATCCACCTACCTCGG - Intergenic
1038590609 8:28833929-28833951 CTACGGCAACTCACCTCTCCGGG + Intronic
1039177606 8:34827091-34827113 CTCAGGCAATCCACCTACCTCGG + Intergenic
1039496357 8:37983603-37983625 CTCAGGCAACTGACCCACCTCGG + Intergenic
1039501190 8:38018772-38018794 CTCAGGCAATCCACCTACCTTGG + Intergenic
1039618749 8:38977478-38977500 CTGAGTCAGCACATCTATCTGGG - Intronic
1040905052 8:52460174-52460196 CTCAGGCATCTCACAGATCTGGG - Intronic
1040927649 8:52701356-52701378 CTCAGGTAATTCACCTGTCTCGG + Intronic
1041007467 8:53509148-53509170 CTGTGGCATCTGTCCTATCTGGG - Intergenic
1041099042 8:54378339-54378361 ATGAGGCAACTCATCTCTCTAGG - Intergenic
1042157109 8:65856200-65856222 CTCAGGCAATTCTCTTATCTTGG + Intergenic
1042243172 8:66685020-66685042 CTCAGGCAATCCACCCATCTAGG + Intronic
1042260615 8:66855434-66855456 CTTAGGCAATCCGCCTATCTGGG + Intronic
1044032130 8:87251351-87251373 CTGAGGCAATCCACCTGCCTTGG - Intronic
1045201663 8:99989608-99989630 CTCAGGCAATCCACCTGTCTAGG - Intronic
1046197542 8:110884144-110884166 CTGTGGTAATTCACCTATCGGGG - Intergenic
1046457072 8:114480452-114480474 ATAAGACAACTCACATATCTTGG - Intergenic
1047100999 8:121675729-121675751 CTGAGGCAATTCACCTGCCTGGG + Intergenic
1047232869 8:123012193-123012215 CTCAGGCAAGTCACCTGCCTCGG - Intergenic
1047833105 8:128657614-128657636 CTGTGGTGAGTCACCTATCTGGG + Intergenic
1048018083 8:130515057-130515079 CTCAGGCAATCCACCTACCTTGG - Intergenic
1048246513 8:132808942-132808964 CTCAAGCAACTCACCCAGCTCGG + Intronic
1048343166 8:133556127-133556149 CTCAGGCAATCCACCCATCTCGG + Intronic
1048853895 8:138670118-138670140 CTCAGGCAATTCACCTGCCTTGG + Intronic
1048983676 8:139717464-139717486 CTCAGGCAATCCACCTACCTCGG - Intergenic
1049000814 8:139824794-139824816 CTCAGGCAATTCACCCACCTCGG + Intronic
1050517064 9:6455749-6455771 CTGAAGCAATTCTCCCATCTTGG - Intronic
1051055534 9:12980667-12980689 CTGAGACAACTCGACTATTTGGG + Intergenic
1051653393 9:19353392-19353414 CTCAGGCAATCCACCTGTCTGGG - Intronic
1051686747 9:19665890-19665912 CTGAAGCACCTCACCCACCTCGG + Intronic
1052795840 9:32922699-32922721 CTCAGGCAATCCACCCATCTCGG - Intergenic
1053115826 9:35501341-35501363 CTCAGGCAATTCACCTTACTTGG - Intronic
1053486492 9:38460694-38460716 TTCAAGCAACTCGCCTATCTTGG + Intergenic
1053794831 9:41716860-41716882 CTGAGGTGATCCACCTATCTCGG + Intergenic
1053796840 9:41734322-41734344 CTGAAGCAATTCACCTGCCTTGG - Intergenic
1053933949 9:43133129-43133151 CTGAATTAACCCACCTATCTGGG - Intergenic
1054148349 9:61580544-61580566 CTGAAGCAATTCACCTGCCTTGG + Intergenic
1054150345 9:61597958-61597980 CTGAGGTGATCCACCTATCTCGG - Intergenic
1054171776 9:61846625-61846647 CTCAGGTAATCCACCTATCTTGG + Intergenic
1054183241 9:61928918-61928940 CTGAGGTGATCCACCTATCTCGG + Intergenic
1054185255 9:61946406-61946428 CTGAAGCAATTCACCTGCCTTGG - Intergenic
1054468093 9:65511632-65511654 CTGAAGCAATTCACCTGCCTTGG + Intergenic
1054470116 9:65529064-65529086 CTGAGGTGATCCACCTATCTCGG - Intergenic
1054653254 9:67642090-67642112 CTGAAGCAATTCACCTGCCTTGG + Intergenic
1054655265 9:67659556-67659578 CTGAGGTGATCCACCTATCTCGG - Intergenic
1054665759 9:67734187-67734209 CTCAGGTAATCCACCTATCTTGG - Intergenic
1054780657 9:69163400-69163422 CTGAGGCAATCCACCTGCCTTGG - Intronic
1055840452 9:80497010-80497032 CTGAGGCAATTCACCTGCCTCGG + Intergenic
1056426897 9:86486504-86486526 CTCAAGCAATTCACCCATCTTGG - Intergenic
1056664165 9:88567976-88567998 GTGAGGCAAGTCACGTACCTAGG - Intronic
1057103002 9:92381515-92381537 CTCAAGCAATTGACCTATCTTGG + Intronic
1057205865 9:93172155-93172177 CTCAGGCAACCCACCTGCCTTGG + Intergenic
1057206461 9:93176088-93176110 CTCAGGCAACCCACCCACCTCGG + Intergenic
1058660365 9:107261014-107261036 CTGAGGCAATTCACAGAACTAGG - Intergenic
1058874375 9:109230408-109230430 CTTAGGTAACTCACTTATCTGGG + Intronic
1059422663 9:114201944-114201966 CTGAGGCCACACAGCTTTCTAGG - Intronic
1059479822 9:114580448-114580470 CTGAGCCCACTCACCCAACTTGG - Intergenic
1059511948 9:114856698-114856720 TTGAGGCAAGTCGCCAATCTTGG + Intergenic
1059802861 9:117768347-117768369 CTCAGGCAATCCACCCATCTCGG + Intergenic
1060170609 9:121458141-121458163 CTCAGGCAATCCACCTGTCTCGG + Intergenic
1060178661 9:121516370-121516392 CTCAAGCAATTCACCTGTCTTGG - Intergenic
1061136138 9:128734987-128735009 CTCAGGCAATTCTCCTGTCTCGG + Intronic
1061783867 9:133012467-133012489 CTCAGGCAATTCACCTGCCTCGG - Intergenic
1061911138 9:133725437-133725459 CTCAGGCAATCCACCCATCTCGG - Intronic
1185669742 X:1798401-1798423 CTGAGCCAACCCACATTTCTGGG + Intergenic
1186939550 X:14490146-14490168 CTCAGGCTACTCACCTGCCTGGG + Intergenic
1186940010 X:14496157-14496179 CTGAGCCAACACACTTACCTAGG - Intergenic
1187347434 X:18479084-18479106 CTGAAGCAATCCTCCTATCTTGG + Intronic
1187362475 X:18641391-18641413 CAGAGGAAACTCCCCTACCTTGG + Exonic
1187454413 X:19428731-19428753 CTCAGGCAATCCACCTACCTCGG - Intronic
1187830544 X:23376743-23376765 CTGAGGCCACCCACCTAGCAGGG - Intronic
1189583522 X:42432890-42432912 ATGATGCCACTCACCAATCTGGG + Intergenic
1190168653 X:48094012-48094034 CTCAGGCAATCCACCCATCTTGG - Intergenic
1191811667 X:65196148-65196170 CTGAGGCAGCGCACCTTTCGAGG - Intergenic
1192570649 X:72201356-72201378 CTCAGGCAATCCACCTGTCTCGG - Intronic
1193158386 X:78199298-78199320 CTCAAGCAACTCACCCACCTTGG + Intergenic
1193873048 X:86825179-86825201 CTGAGGCAATCCACCTGCCTCGG - Intronic
1193947943 X:87762357-87762379 CTAAGGCAATCCACCTGTCTCGG + Intergenic
1194015277 X:88611512-88611534 CTCAAACAATTCACCTATCTTGG - Intergenic
1194089634 X:89568715-89568737 CTGAGGCCCCTCTCTTATCTGGG - Intergenic
1197160135 X:123313666-123313688 ATCAGGCAAGTCACTTATCTGGG - Intronic
1197642452 X:128981934-128981956 CTCAGGCAATCCACCTACCTTGG + Intergenic
1198371564 X:135994338-135994360 CTCAGGCAATCCACCCATCTCGG + Intronic
1198549019 X:137725225-137725247 CTCAAGCAACCCTCCTATCTTGG + Intergenic
1199678445 X:150207319-150207341 CTGTGGCCACTCACCTCTTTGGG - Intergenic
1200442288 Y:3224768-3224790 CTGAGGCCCCTCTCTTATCTGGG - Intergenic
1201303710 Y:12532924-12532946 CTCAGGCAACTCTCCTGCCTTGG - Intergenic
1202031745 Y:20582442-20582464 CTCAGGCAATTCACCTGCCTTGG + Intronic
1202267212 Y:23032841-23032863 CTCAAGCAACCCACCTACCTTGG + Intergenic
1202420204 Y:24666585-24666607 CTCAAGCAACCCACCTACCTTGG + Intergenic
1202450582 Y:25003497-25003519 CTCAAGCAACCCACCTACCTTGG - Intergenic