ID: 1008469794

View in Genome Browser
Species Human (GRCh38)
Location 6:51871531-51871553
Sequence GTGGCTACAAAGATGGAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008469790_1008469794 3 Left 1008469790 6:51871505-51871527 CCAGTGGTTTAAAGCAAGAGGAG 0: 1
1: 0
2: 0
3: 12
4: 148
Right 1008469794 6:51871531-51871553 GTGGCTACAAAGATGGAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008469794 Original CRISPR GTGGCTACAAAGATGGAGCA AGG Intronic
No off target data available for this crispr