ID: 1008471384

View in Genome Browser
Species Human (GRCh38)
Location 6:51889101-51889123
Sequence GTGATCAGGATTGAATCATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 231}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008471384_1008471393 3 Left 1008471384 6:51889101-51889123 CCACATGATTCAATCCTGATCAC 0: 1
1: 0
2: 0
3: 16
4: 231
Right 1008471393 6:51889127-51889149 GGGGTTTTCCATGGCCTGGCTGG No data
1008471384_1008471395 15 Left 1008471384 6:51889101-51889123 CCACATGATTCAATCCTGATCAC 0: 1
1: 0
2: 0
3: 16
4: 231
Right 1008471395 6:51889139-51889161 GGCCTGGCTGGTGCGAGACAAGG 0: 1
1: 0
2: 1
3: 19
4: 195
1008471384_1008471392 -1 Left 1008471384 6:51889101-51889123 CCACATGATTCAATCCTGATCAC 0: 1
1: 0
2: 0
3: 16
4: 231
Right 1008471392 6:51889123-51889145 CCTGGGGGTTTTCCATGGCCTGG No data
1008471384_1008471397 24 Left 1008471384 6:51889101-51889123 CCACATGATTCAATCCTGATCAC 0: 1
1: 0
2: 0
3: 16
4: 231
Right 1008471397 6:51889148-51889170 GGTGCGAGACAAGGAATGTCTGG 0: 1
1: 0
2: 0
3: 8
4: 120
1008471384_1008471390 -6 Left 1008471384 6:51889101-51889123 CCACATGATTCAATCCTGATCAC 0: 1
1: 0
2: 0
3: 16
4: 231
Right 1008471390 6:51889118-51889140 GATCACCTGGGGGTTTTCCATGG 0: 1
1: 0
2: 0
3: 7
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008471384 Original CRISPR GTGATCAGGATTGAATCATG TGG (reversed) Intronic
903358221 1:22761122-22761144 GAGATCAGAAGAGAATCATGGGG - Intronic
908886214 1:68791855-68791877 GTGGTGATAATTGAATCATGGGG - Intergenic
909518231 1:76536526-76536548 GTGGAGATGATTGAATCATGGGG - Intronic
911474972 1:98363054-98363076 GTGGAGAGAATTGAATCATGGGG - Intergenic
911855220 1:102868308-102868330 GTGAGAGGTATTGAATCATGCGG - Intergenic
913091630 1:115480148-115480170 GTGAAGATGATTGGATCATGGGG - Intergenic
916273543 1:162969336-162969358 GTGAAGATAATTGAATCATGAGG + Intergenic
916440053 1:164815757-164815779 GTGAACTTAATTGAATCATGGGG - Intronic
917510012 1:175662068-175662090 GAGAGCAGGATTGGAGCATGGGG + Intronic
917914837 1:179690923-179690945 GTGAAAAGGATGGAAGCATGAGG + Exonic
918404973 1:184203072-184203094 GTGGGAGGGATTGAATCATGGGG - Intergenic
921784768 1:219216973-219216995 ATGATCAAGATGGAATAATGGGG - Intergenic
922555285 1:226527873-226527895 GTGGTCAGGATGGAATCTTTTGG + Intergenic
923454240 1:234149255-234149277 GTGAACAGGATTTCAACATGAGG + Intronic
1063936036 10:11079467-11079489 GTGAAGACGATTGAATTATGGGG + Intronic
1068221921 10:54056563-54056585 GTGAAGATAATTGAATCATGGGG - Intronic
1068365226 10:56039743-56039765 GTGTCCTGAATTGAATCATGAGG + Intergenic
1070368189 10:75756629-75756651 GTGATGAGGATAGAATTATTGGG + Intronic
1076276439 10:129203260-129203282 GTGGAGATGATTGAATCATGGGG + Intergenic
1078079192 11:8191830-8191852 GTGGAGATGATTGAATCATGTGG + Intergenic
1084016367 11:66385036-66385058 ATGATCAGTATAGACTCATGTGG + Intergenic
1085656281 11:78318204-78318226 GGGATCAGGAGTGAATCTGGTGG + Intronic
1085788519 11:79475795-79475817 GTGGTTATAATTGAATCATGGGG - Intergenic
1088069366 11:105762634-105762656 GGGACCTGGTTTGAATCATGGGG + Intronic
1089064338 11:115651038-115651060 GTGATCAGGATAGAAAAAAGGGG - Intergenic
1089385649 11:118065928-118065950 GTGACCAGGCTAGAATCAGGAGG + Intergenic
1091007947 11:131970678-131970700 GGGATCAGGAATGAAGAATGAGG - Intronic
1091955114 12:4633997-4634019 GTGCTCAGGTTTGAATAAAGTGG - Intronic
1094754013 12:33445140-33445162 GTGAAGATAATTGAATCATGGGG - Intergenic
1097558297 12:61167536-61167558 GAGGTGACGATTGAATCATGGGG - Intergenic
1097757782 12:63426425-63426447 GTGGACATAATTGAATCATGGGG - Intergenic
1098020710 12:66152911-66152933 AAGATCAGGGATGAATCATGTGG + Intronic
1099371229 12:81834033-81834055 GTGGACATAATTGAATCATGGGG + Intergenic
1099487021 12:83241429-83241451 GTTGTCAGGATTGAATGCTGTGG - Intergenic
1101309188 12:103560949-103560971 TTGATGTGGATTGAATGATGTGG - Intergenic
1102636690 12:114330870-114330892 TTGGCCAGAATTGAATCATGAGG + Intergenic
1103051563 12:117784228-117784250 GTGGAGATGATTGAATCATGGGG + Intronic
1103884728 12:124191881-124191903 GTGAGTATGCTTGAATCATGGGG - Intronic
1104083227 12:125450907-125450929 TTTAACTGGATTGAATCATGAGG + Intronic
1104611271 12:130229701-130229723 GTGAAGGTGATTGAATCATGGGG - Intergenic
1104656907 12:130580302-130580324 GTGGAGATGATTGAATCATGGGG + Intronic
1106296681 13:28420500-28420522 GTGATCAATATTAAAACATGAGG + Intronic
1106795938 13:33206013-33206035 TTGATCAGGCTAGAATGATGTGG - Intronic
1107377196 13:39816800-39816822 GTGAAGATAATTGAATCATGGGG - Intergenic
1109679844 13:65736445-65736467 GTTACCAAGATTGAATCTTGAGG + Intergenic
1110106045 13:71677680-71677702 GTGATTAGGACTGAATCAATAGG + Intronic
1111359763 13:87160941-87160963 TTGTTCAGGGTTGAATTATGAGG + Intergenic
1112426679 13:99308576-99308598 GTAAACAGAATTGAATCATTTGG + Intronic
1112963407 13:105157055-105157077 GTGAAGATAATTGAATCATGGGG - Intergenic
1114226630 14:20744637-20744659 GAGTTCAGGACTGAATCTTGAGG + Intronic
1114959996 14:27874007-27874029 GTGATGAGGGAAGAATCATGAGG - Intergenic
1115547154 14:34474325-34474347 GAGATGATAATTGAATCATGGGG + Intergenic
1116215093 14:42006433-42006455 GTGAAGATAATTGAATCATGGGG - Intergenic
1117626734 14:57647766-57647788 GTGATCAGGTGTGAAGGATGAGG - Intronic
1117706017 14:58468947-58468969 GTGATCAGGATCCAAGAATGAGG - Intronic
1117847436 14:59925889-59925911 GTGGACATAATTGAATCATGGGG + Intronic
1118377964 14:65193168-65193190 GTGGACATAATTGAATCATGGGG + Intergenic
1120028634 14:79614629-79614651 GTGGTCAGTATTGAATTATGGGG + Intronic
1120512291 14:85430243-85430265 GGGAAGATGATTGAATCATGGGG - Intergenic
1121264191 14:92588576-92588598 GTCATGAGGGTGGAATCATGAGG - Intronic
1121948547 14:98147517-98147539 ATATTCAGAATTGAATCATGTGG - Intergenic
1122380082 14:101296797-101296819 GGGATCCCCATTGAATCATGGGG - Intergenic
1123141481 14:106083337-106083359 GTGATCAGGATTGAACACAGAGG - Intergenic
1124400222 15:29341528-29341550 GTGATCAGGTTTGCATGTTGTGG - Intronic
1125973250 15:43929416-43929438 GTAAGCAGGATTGAATAAAGTGG - Intronic
1126332027 15:47543310-47543332 GTGAAGATAATTGAATCATGGGG + Intronic
1127746946 15:61987534-61987556 GTGGTAATAATTGAATCATGGGG - Intronic
1129187397 15:73918098-73918120 GCGATCAGGAGTGAGGCATGGGG + Intergenic
1129924040 15:79346357-79346379 GTGGACATAATTGAATCATGGGG + Intronic
1134269280 16:12719428-12719450 GTGGACATAATTGAATCATGGGG - Intronic
1137810223 16:51345541-51345563 GTGTTCAGTATAGTATCATGAGG - Intergenic
1138173079 16:54871276-54871298 GTGATCATGAGTGAATTATCGGG - Intergenic
1138517279 16:57543137-57543159 GTGACCTGGATTGGATCCTGGGG + Exonic
1138893244 16:61170782-61170804 GTGAAGATAATTGAATCATGGGG - Intergenic
1139172899 16:64651933-64651955 GTGAAGATAATTGAATCATGGGG - Intergenic
1139290399 16:65853139-65853161 GTGAAGATAATTGAATCATGGGG + Intergenic
1143153002 17:4818661-4818683 GGGATCAGGACAGAATCAGGAGG - Intronic
1149392212 17:56203435-56203457 GAGATCAGGAATGAATATTGAGG - Intronic
1149465431 17:56875034-56875056 GTAATCAGGATTAAATAAGGTGG + Intergenic
1151143863 17:72020676-72020698 GTGGAGATGATTGAATCATGGGG - Intergenic
1153047600 18:870990-871012 GTGAAGATAATTGAATCATGGGG + Intergenic
1153073218 18:1131167-1131189 GTGATCAGGATTAAAGACTGTGG - Intergenic
1155789814 18:29951391-29951413 GTGATCAGAATTGTATTATCAGG + Intergenic
1155992406 18:32292552-32292574 GTGAAGATAATTGAATCATGGGG + Intronic
1158268700 18:55688666-55688688 GTTTTTAGGATTGAGTCATGAGG - Intergenic
1159507240 18:69353647-69353669 GTGGGAATGATTGAATCATGGGG - Intergenic
1162156357 19:8680729-8680751 GAGATCAGGATTGAAATAGGGGG + Intergenic
1163668377 19:18613513-18613535 CAGATCAGGCTTGAATCCTGGGG - Intronic
1164783763 19:30913355-30913377 GTGATCAGGATGGGATCTGGGGG + Intergenic
1165636495 19:37344668-37344690 GAGATTTGGAGTGAATCATGAGG + Exonic
1168658029 19:58145806-58145828 GTGATCAGGTTTTTGTCATGTGG - Intronic
926047794 2:9722661-9722683 GTAATGAGGATGGAAGCATGTGG - Intergenic
926226332 2:10969699-10969721 GTGAAGATAATTGAATCATGGGG - Intergenic
927675450 2:25102593-25102615 GTGGAGAGAATTGAATCATGGGG - Intronic
927816386 2:26221227-26221249 GCCATCAGGTTTGAATCACGTGG - Intronic
928224321 2:29434795-29434817 GAGCTCAGGGTTGAATGATGAGG + Intronic
931897186 2:66745183-66745205 GTGGAGATGATTGAATCATGGGG + Intergenic
932656568 2:73615793-73615815 GTGTAGATGATTGAATCATGGGG + Intergenic
935996892 2:108783821-108783843 GTGAAAAAGATTGAATCATTTGG + Exonic
937867986 2:126768295-126768317 GTGAAGATAATTGAATCATGGGG - Intergenic
938697162 2:133844608-133844630 GTTATGAGGTTTGCATCATGTGG + Intergenic
939783764 2:146482573-146482595 GTTATCAGGATTAAATATTGTGG - Intergenic
940548239 2:155117421-155117443 GTGAAGATAATTGAATCATGGGG + Intergenic
940795943 2:158078968-158078990 GTGGTGATAATTGAATCATGGGG + Intronic
941260543 2:163291556-163291578 GTGGAGAGAATTGAATCATGGGG + Intergenic
941317752 2:164015953-164015975 GTGATTAGAATTGAGTCATAAGG + Intergenic
942986931 2:182154509-182154531 GTGAAGATAATTGAATCATGGGG + Intronic
944916424 2:204365174-204365196 GTGACCAGGGTTGAAACATCAGG - Intergenic
946472528 2:219975483-219975505 GTGGTGATAATTGAATCATGGGG + Intergenic
946510061 2:220346352-220346374 GTGGAGAGGATTGAATCATGGGG - Intergenic
947145657 2:227061897-227061919 GTGATCATGATTCACTCTTGAGG + Intronic
947312642 2:228821097-228821119 GTGGACATAATTGAATCATGGGG - Intergenic
1169372582 20:5039856-5039878 GTGTCCAGGATTGCATTATGTGG + Intergenic
1169848035 20:10016623-10016645 GTGAAGATAATTGAATCATGGGG - Intronic
1170133194 20:13044892-13044914 GTGATCAGGAGTGATTCTTGAGG - Intronic
1172633267 20:36393077-36393099 ATGTTCAGGAAGGAATCATGTGG + Intronic
1173485082 20:43435234-43435256 GTGGAGATGATTGAATCATGGGG - Intergenic
1174981575 20:55401383-55401405 GTGAAAAGTATTGGATCATGGGG + Intergenic
1175563718 20:59955207-59955229 GTAATGATGATTGCATCATGAGG - Intergenic
1177055628 21:16297842-16297864 GTGAAGATAATTGAATCATGGGG + Intergenic
1177521900 21:22237706-22237728 GTGGACATCATTGAATCATGGGG + Intergenic
1177529159 21:22337733-22337755 GTGGAGATGATTGAATCATGGGG + Intergenic
1177683955 21:24412521-24412543 GTGGTGATAATTGAATCATGGGG + Intergenic
1178086817 21:29120558-29120580 GTGATGAGAAATGAATTATGTGG - Intronic
1179543275 21:42098226-42098248 GTGAACAGCATTGAGTCGTGGGG - Intronic
1184450612 22:44580417-44580439 GGGATCGGGACTGAATGATGTGG - Intergenic
1184674321 22:46032235-46032257 GTGCTCAGGATTGACAGATGTGG + Intergenic
949240746 3:1868543-1868565 GTGGATATGATTGAATCATGGGG + Intergenic
951631141 3:24722023-24722045 GTCATCTGAATTGAATCATTAGG + Intergenic
955154357 3:56402091-56402113 GTGAAGATAATTGAATCATGGGG - Intronic
955841402 3:63116780-63116802 GTGGGAGGGATTGAATCATGGGG - Intergenic
956174418 3:66459502-66459524 GTGAGCAGGTGTGAATGATGAGG - Intronic
956237861 3:67094909-67094931 GAGCTCTGGATTGAATCAAGGGG - Intergenic
956363081 3:68470051-68470073 GTGAAGATAATTGAATCATGGGG + Intronic
957357744 3:79113967-79113989 GTGGACATGATTGAATCATAGGG + Intronic
957402951 3:79740667-79740689 GTGAAGAGAATTGAATCATGGGG - Intronic
958080149 3:88737066-88737088 GTGCTCAGGGATGAAGCATGTGG - Intergenic
958272148 3:91514590-91514612 TTGATCATAATTGAATCTTGAGG - Intergenic
959299563 3:104579955-104579977 GTGGACATAATTGAATCATGGGG - Intergenic
960025885 3:113008880-113008902 TTGACCAGTATTTAATCATGTGG - Intronic
960564007 3:119115061-119115083 GTGTTGATGATTGAACCATGGGG - Intronic
963803271 3:149698230-149698252 GTGAAGATAATTGAATCATGAGG + Intronic
964466515 3:156998957-156998979 GTGGTGGTGATTGAATCATGGGG + Intronic
964565333 3:158044619-158044641 TCTATCAAGATTGAATCATGAGG + Intergenic
965257270 3:166430022-166430044 TTGACCAAGATTGAATCATGAGG + Intergenic
965733402 3:171796088-171796110 GGGAACTGGATTGAATCATTGGG - Intronic
965967711 3:174515084-174515106 ATTATCAGGAAGGAATCATGAGG + Intronic
966118811 3:176498864-176498886 TGGATCATGATTGGATCATGGGG - Intergenic
966311149 3:178595512-178595534 GTGGTGATAATTGAATCATGGGG + Intronic
967453166 3:189650458-189650480 GTGGAGAAGATTGAATCATGGGG + Intronic
967941240 3:194768197-194768219 GGGATCAGGAATGCTTCATGGGG + Intergenic
968125996 3:196160693-196160715 GTGATCAGGAGTAAATCAGCTGG + Intergenic
969082407 4:4629025-4629047 GTGAGAGGTATTGAATCATGGGG + Intergenic
970121776 4:12761966-12761988 GTGGAGATGATTGAATCATGAGG - Intergenic
970363037 4:15329233-15329255 GTGAACATAATTGAATCATGGGG + Intergenic
970721710 4:18996503-18996525 GTGAAGATAATTGAATCATGGGG - Intergenic
970721974 4:18998491-18998513 GTGGACATGATGGAATCATGGGG - Intergenic
970987122 4:22171625-22171647 GTGGAGAGAATTGAATCATGGGG - Intergenic
974922665 4:68261328-68261350 GTGAAGATTATTGAATCATGGGG - Intergenic
980551047 4:134335668-134335690 GTGCACATGATTGGATCATGAGG + Intergenic
983169830 4:164522812-164522834 GTGAGAGTGATTGAATCATGGGG + Intergenic
983428495 4:167618440-167618462 GTGGACATAATTGAATCATGGGG + Intergenic
983669210 4:170216079-170216101 GTGGGGATGATTGAATCATGGGG + Intergenic
983713132 4:170744452-170744474 TTGTACAGCATTGAATCATGTGG - Intergenic
983844923 4:172506272-172506294 GTGAGGAGGATGGAATCATCAGG - Intronic
983855133 4:172633784-172633806 GTGGAGATGATTGAATCATGAGG + Intronic
984394593 4:179179281-179179303 CCTATCAAGATTGAATCATGAGG - Intergenic
984498528 4:180530010-180530032 GTGGAGATGATTGAATCATGGGG + Intergenic
984865400 4:184276285-184276307 GTGAAGATAATTGAATCATGGGG + Intergenic
985176706 4:187210269-187210291 GCAATTAGGAATGAATCATGAGG - Intergenic
986601679 5:9478966-9478988 GTGAGAGGGATTGAATCATTGGG + Intronic
987165559 5:15194412-15194434 GTGGACATAATTGAATCATGGGG + Intergenic
987197640 5:15543367-15543389 GTGGACACAATTGAATCATGGGG - Intronic
987822359 5:22981876-22981898 GTGGGCATAATTGAATCATGCGG + Intergenic
990006190 5:50946365-50946387 GTGGCCAGTATTGGATCATGAGG + Intergenic
990110650 5:52318930-52318952 TTGATTAGGACTGCATCATGTGG - Intergenic
995337480 5:111016992-111017014 GAGATCAGGATTCAAACAAGGGG - Intergenic
996254437 5:121381186-121381208 GTGAAGATAATTGAATCATGGGG - Intergenic
997796354 5:136815336-136815358 GTGAGCAGGAGGGAAGCATGGGG - Intergenic
998264508 5:140657853-140657875 GTGGTCAGGTCTGAAGCATGAGG + Intronic
998370212 5:141655938-141655960 GTGATCAGAATGGAATCAGAGGG + Intronic
998446362 5:142201659-142201681 ATAACCAGGATTGAGTCATGAGG + Intergenic
1000442394 5:161279385-161279407 TTGGTCAGGCCTGAATCATGTGG + Intergenic
1003353985 6:5347669-5347691 AGGATTAGAATTGAATCATGCGG + Intronic
1007653285 6:43436384-43436406 GTGAGCAGGTTCTAATCATGAGG + Intronic
1008471384 6:51889101-51889123 GTGATCAGGATTGAATCATGTGG - Intronic
1008845973 6:55964551-55964573 GTGATCAGAATTGAATGATTCGG - Intergenic
1011957475 6:93040550-93040572 GGGATCAGGATGGTAACATGCGG + Intergenic
1012648653 6:101722876-101722898 GTGATCAGCATGGAATAATCTGG + Intronic
1014019009 6:116566537-116566559 GTGAAAAGGATTGAGGCATGGGG - Intergenic
1014070369 6:117174968-117174990 GTCATCTTGACTGAATCATGAGG + Intergenic
1016346504 6:143119499-143119521 GTGAACAGCATTGAAGCATTAGG + Intronic
1019934465 7:4245288-4245310 GAGATGAGGATGGAGTCATGAGG - Intronic
1022348309 7:29539509-29539531 GTGAGCAGGACTGCATCTTGTGG + Intergenic
1024296926 7:47851739-47851761 GTGAACTGAATTTAATCATGAGG + Intronic
1024585748 7:50840462-50840484 GTAAGCAAGATTTAATCATGTGG + Intergenic
1026365014 7:69639567-69639589 CTGATCACAATTGAAGCATGTGG + Intronic
1026424408 7:70275668-70275690 GTGGAGAGAATTGAATCATGGGG + Intronic
1028339096 7:89695481-89695503 GTGGTAAGGATTGCATCTTGTGG + Intergenic
1029618374 7:101674277-101674299 GTGATTTGGATTGAATACTGAGG - Intergenic
1030749803 7:113217583-113217605 AAGAACAGGATTGACTCATGTGG - Intergenic
1033763305 7:144460692-144460714 CTGACCTGAATTGAATCATGGGG + Intronic
1034012983 7:147550302-147550324 GTGGAAATGATTGAATCATGGGG + Intronic
1036959846 8:13232168-13232190 ATGATCAGGCTTGAAGCATGGGG + Intronic
1037104867 8:15094714-15094736 GTGAAGATAATTGAATCATGGGG + Intronic
1038197112 8:25378546-25378568 GTGAACAGGAATGAAGCAGGAGG + Intronic
1038913457 8:31993444-31993466 GTGGAGATGATTGAATCATGGGG + Intronic
1039950289 8:42166088-42166110 GTGATGTGGAATGAATCATTTGG + Intronic
1041349439 8:56933994-56934016 GTGAAGATAATTGAATCATGGGG - Intergenic
1043704507 8:83331453-83331475 GTGAAGATGATTGAATCATGGGG - Intergenic
1043826406 8:84934407-84934429 GTGATTAGGACTGAATTAAGGGG + Intergenic
1045259737 8:100561777-100561799 GTGAAGATAATTGAATCATGGGG + Intergenic
1045314515 8:101031447-101031469 GTGGAGAGAATTGAATCATGGGG + Intergenic
1045825390 8:106391173-106391195 TTGATAATTATTGAATCATGAGG + Intronic
1046680808 8:117168085-117168107 GTGAAGATAATTGAATCATGGGG - Intronic
1046831584 8:118752090-118752112 GTGAAGATAATTGAATCATGGGG + Intergenic
1050121425 9:2312734-2312756 GTGAAGACAATTGAATCATGGGG + Intergenic
1051395140 9:16612324-16612346 GTGTACAGTATTGTATCATGAGG - Intronic
1052526962 9:29630378-29630400 GTGGACATAATTGAATCATGGGG + Intergenic
1052600034 9:30615652-30615674 GTGAAGATTATTGAATCATGGGG + Intergenic
1053572085 9:39319651-39319673 GTGAACATAATTGAATCATGGGG + Intergenic
1053882520 9:42610691-42610713 GTGGACATAATTGAATCATGGGG - Intergenic
1053890149 9:42683611-42683633 GTGGACATAATTGAATCATGGGG + Intergenic
1054093641 9:60878362-60878384 GTGAACATAATTGAATCATGGGG + Intergenic
1054115124 9:61154282-61154304 GTGAACATAATTGAATCATGGGG + Intergenic
1054125060 9:61299360-61299382 GTGAACATAATTGAATCATGGGG - Intergenic
1054221545 9:62418159-62418181 GTGGACATAATTGAATCATGGGG - Intergenic
1054229169 9:62491014-62491036 GTGGACATAATTGAATCATGGGG + Intergenic
1054592632 9:67028252-67028274 GTGAACATAATTGAATCATGGGG - Intergenic
1058777699 9:108301139-108301161 GTGACCAGGAGGAAATCATGAGG + Intergenic
1060710797 9:125861829-125861851 GTGATGAGGAGTGACTAATGGGG + Intronic
1060762011 9:126261536-126261558 GTGGTGATAATTGAATCATGGGG + Intergenic
1061729301 9:132601157-132601179 GTGAACTGGATGAAATCATGAGG + Intronic
1185951502 X:4440440-4440462 GTGGAGATGATTGAATCATGGGG - Intergenic
1187479971 X:19646429-19646451 GTGATCATGATTGATGCCTGAGG + Intronic
1187626399 X:21119072-21119094 GTCAACAGGATTGCATGATGTGG - Intergenic
1188317190 X:28689257-28689279 GTGAAGATAATTGAATCATGGGG + Intronic
1188491676 X:30744699-30744721 GTGAAGATAATTGAATCATGAGG - Intergenic
1189556089 X:42146968-42146990 GTCCTCAGGATTGAGTGATGTGG - Intergenic
1191965554 X:66753278-66753300 GTGAAGATAATTGAATCATGGGG - Intergenic
1192680552 X:73249007-73249029 GAGATCCCAATTGAATCATGGGG + Intergenic
1198462651 X:136878291-136878313 ATGATCTGGATTGAAACATAAGG + Intronic
1198925702 X:141791990-141792012 GTCCTCTGGATTGAATCCTGAGG + Intergenic
1199095879 X:143737983-143738005 ATGATCAGGTTTGTGTCATGGGG - Intergenic
1199410461 X:147516619-147516641 GTTATCAGGATTCATTCATGTGG + Intergenic
1199683519 X:150243909-150243931 GTGAAGACGATTGAATCATGGGG - Intergenic
1199999445 X:153050292-153050314 GTGGAGATGATTGAATCATGGGG + Intergenic
1201703626 Y:16911267-16911289 GTGGACATAATTGAATCATGGGG + Intergenic