ID: 1008473557

View in Genome Browser
Species Human (GRCh38)
Location 6:51911253-51911275
Sequence CCTATTAAGCATCTATTTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 166}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008473557 Original CRISPR CCTATTAAGCATCTATTTCA GGG (reversed) Intronic
900542536 1:3211094-3211116 CCCACTAGGCATCTATTTCTTGG + Intronic
906931086 1:50170196-50170218 TCTATTGAGCATCTGTTTTATGG + Intronic
907855260 1:58297124-58297146 CCTATTAAGCTTCCATTTCAAGG - Intronic
908227779 1:62073310-62073332 CCTTTTAAGCATCTGTTTAGGGG - Intronic
910629128 1:89338611-89338633 CCAATTAAGCCCCTGTTTCATGG + Intergenic
910899986 1:92110028-92110050 TCTATTAAGCTAATATTTCATGG + Intronic
913456078 1:119032221-119032243 CTTATTAAGAATATAATTCAGGG + Exonic
916200851 1:162270317-162270339 CCTCTTTAGCATCTATTACGGGG - Intronic
919435113 1:197548792-197548814 TCTATTAACCTTCTTTTTCAGGG - Intronic
920241879 1:204558569-204558591 AATATTAAACATCAATTTCAGGG + Intergenic
921454934 1:215359426-215359448 CCTACAAGGCATCTCTTTCAGGG - Intergenic
923829114 1:237535800-237535822 TTTATTAAGCATCAATTTAATGG - Intronic
924542670 1:244995982-244996004 CCTATTAGTCATCTATTTTGTGG + Intronic
1064773950 10:18754749-18754771 CCTATTCAGCATTATTTTCAAGG - Intergenic
1066240738 10:33532289-33532311 CCTGTGAGGCTTCTATTTCATGG + Intergenic
1067904508 10:50276639-50276661 CCTACCAAGAATCTACTTCACGG + Intergenic
1068965403 10:62906929-62906951 GTTATTATTCATCTATTTCATGG + Intronic
1069475397 10:68727606-68727628 AATATTAAGAATATATTTCAAGG - Intronic
1070492116 10:76987112-76987134 TTTATTAAGCATGTATCTCAAGG - Intronic
1071828663 10:89350613-89350635 CCTTTTAAGCATTTCTTGCAGGG + Intronic
1072379716 10:94855297-94855319 TCTGTTAAGCATCTTGTTCAAGG + Intergenic
1076765710 10:132631798-132631820 CCTATGAAGCATCCAGTTCAAGG + Intronic
1079646658 11:22871250-22871272 CTTATGAAGTCTCTATTTCAGGG + Intergenic
1080210427 11:29779577-29779599 CCTCATAAGCCTCTAATTCAAGG + Intergenic
1088079364 11:105891982-105892004 TCTATTAAAAATCTTTTTCAAGG - Intronic
1091187597 11:133660270-133660292 CTTATTAAACATCCATTTAAAGG + Intergenic
1091243874 11:134075029-134075051 CCTTTAAAGCATCTCTGTCAGGG + Intronic
1092874952 12:12839848-12839870 CCTCTTCAGCATCTATGTCTGGG + Intergenic
1094309439 12:29062403-29062425 CTTATTAATTATTTATTTCATGG + Intergenic
1096360927 12:50985944-50985966 CCTATTAATAAATTATTTCAAGG + Intronic
1100694133 12:97072930-97072952 CCTAATGATCATCTATTTCCTGG + Intergenic
1104279942 12:127367371-127367393 CCAAATAGGCATCCATTTCAAGG + Intergenic
1105462684 13:20607011-20607033 TCTATTAAGAATTTATATCAGGG + Intronic
1105764044 13:23540678-23540700 CCTATTAAATATCTCTTTCTGGG - Intergenic
1105802914 13:23925220-23925242 CATATTAAGAATCAATTTCTGGG + Intergenic
1107961136 13:45560302-45560324 CCTATAAAAAATCTATCTCATGG - Intronic
1109856949 13:68142869-68142891 CATACTTAGCATATATTTCAGGG + Intergenic
1110115028 13:71803657-71803679 CCTATTAGACATTTATTTCGTGG + Intronic
1111127626 13:83931656-83931678 CATATTATGCTTCTATTTCATGG + Intergenic
1111349702 13:87011370-87011392 CTTATTAACCTTATATTTCATGG - Intergenic
1111680010 13:91430655-91430677 CTGTTTAAGCATCTATGTCAAGG + Intronic
1113321779 13:109240185-109240207 GCTATTTTGTATCTATTTCAGGG + Intergenic
1114134232 14:19828338-19828360 CTTATTAAACACCTTTTTCATGG - Exonic
1114167879 14:20240261-20240283 CCTATTGAGCACCTTATTCAAGG + Intergenic
1119590399 14:75881871-75881893 CTTTTTAAGCATCTACTTGAAGG + Intronic
1119762567 14:77161921-77161943 AATATTCAGCATCTGTTTCAGGG + Intronic
1124585674 15:31004270-31004292 CCTCTTATCCATCCATTTCACGG + Intronic
1126228763 15:46300802-46300824 CTTCTTAAGCATCTCTTTCCTGG + Intergenic
1126481681 15:49130172-49130194 CCTATTATGGAGCTATTTGAAGG - Intronic
1127183937 15:56457864-56457886 CCTCTTAAGCATTTATCCCAGGG + Intronic
1139162157 16:64523489-64523511 CAGAGTAAACATCTATTTCAAGG - Intergenic
1140156498 16:72433456-72433478 CCTTTTAAACATGTATTTAAAGG + Intergenic
1141919241 16:87124215-87124237 CCTAGTGAGCATCTTTCTCAAGG - Intronic
1151044673 17:70905236-70905258 CATATTTTGCATATATTTCATGG - Intergenic
1153306958 18:3640146-3640168 TTTATTAAGCATCTATCACAGGG - Intronic
1153534281 18:6084024-6084046 CATGTTAAGCATCCAGTTCAGGG - Intronic
1154365477 18:13704394-13704416 CCTATTGTGCTTTTATTTCAAGG - Intronic
1156688835 18:39681878-39681900 TTTATTAAGCATTTACTTCAAGG + Intergenic
1156996812 18:43478884-43478906 CCTATACAGCATCTGTTCCATGG - Intergenic
1158830998 18:61278366-61278388 CCTATTAATGATCTAGATCAAGG - Intergenic
1159856087 18:73589845-73589867 CCTATTTTCCATCTATTTTATGG - Intergenic
1159869489 18:73744156-73744178 TCTATTAGGAATTTATTTCAGGG - Intergenic
1163444744 19:17339707-17339729 CCTATCAAGCATGGATCTCAGGG + Intronic
1164926171 19:32131724-32131746 CCTATTTAGCCCCTATCTCATGG - Intergenic
1164926194 19:32131864-32131886 CCTATTTAGCCCCTATCTCATGG - Intergenic
1164926246 19:32132179-32132201 CCTATTTAGCCCCTATCTCATGG - Intergenic
1164926262 19:32132284-32132306 CCTATTTAGCCCCTATCTCATGG - Intergenic
1165697380 19:37911115-37911137 TCTATTAAGTATCTATTGCTAGG + Intronic
1167196035 19:48029328-48029350 CATTTTAAACATCTAATTCATGG + Intergenic
1167673134 19:50867334-50867356 CATATTAAACATTTGTTTCATGG - Intronic
928153595 2:28855666-28855688 CCTATTAAACATCCAAGTCAAGG + Intronic
932626288 2:73298988-73299010 GGTATTAAGCCTCTATATCACGG - Intergenic
933523712 2:83409155-83409177 CAGATTAAGAATATATTTCAAGG - Intergenic
934727938 2:96637283-96637305 CCTATTGAGTATCCATTTCACGG + Intronic
935171571 2:100614532-100614554 CCTGCTAAGAATCTATTGCAAGG - Intergenic
939093646 2:137807297-137807319 CTTATTATGCTTCTATTACATGG + Intergenic
940361215 2:152798161-152798183 CCTAGGAAGCATGGATTTCAAGG + Intergenic
943564530 2:189501693-189501715 CATAGTAAGAATCTATTTCTAGG + Intergenic
944124787 2:196280935-196280957 CCTATTAACCATCTTGTTTAAGG + Intronic
945205900 2:207332107-207332129 CCTCTAAAGCATCTTTTTCCTGG + Intergenic
948176516 2:235947810-235947832 CCTATAAAGCATTTAATCCAGGG - Intronic
1169730016 20:8776682-8776704 TCTAATAAGCATTTGTTTCAAGG - Intronic
1170456919 20:16542025-16542047 CCTATAAAGCATCATTTTAAAGG - Intronic
1171440165 20:25154095-25154117 CCTATTAACAATTTATTCCATGG + Intergenic
1175353551 20:58344251-58344273 TTTATTAAGTATCTATTGCAAGG - Intronic
1181950674 22:26551419-26551441 CTTATTAACCATCCATTTCCTGG + Intronic
1183008126 22:34920464-34920486 TTTGTTAAGAATCTATTTCATGG - Intergenic
949138072 3:595520-595542 CTTGCTAAGCATTTATTTCAAGG - Intergenic
952040427 3:29255096-29255118 GCGATTAAGCAACTTTTTCAAGG + Intergenic
952811016 3:37402727-37402749 CCTGATAAGCAGCTATTGCAAGG - Intronic
959338447 3:105096476-105096498 CCAATTAAACATCTATTTCCTGG + Intergenic
961638157 3:128346991-128347013 CCTATTAACCATTTATATTAGGG - Intronic
961979667 3:131063633-131063655 CTTATTAAGCCTCCAGTTCAAGG - Intronic
962194735 3:133351687-133351709 CTTCATAAGCCTCTATTTCATGG + Intronic
962706558 3:138050077-138050099 TATAATCAGCATCTATTTCATGG - Intergenic
964099213 3:152968566-152968588 ACTTATAAGCATCTATTTCCAGG + Intergenic
965563915 3:170090579-170090601 CTTAATAAGCATCCATTTCTTGG - Exonic
966088663 3:176103063-176103085 GCTATTAAGCATCTTCTTCCAGG + Intergenic
967721334 3:192819538-192819560 CCTCTTATGCTTCTATTTGAGGG + Intronic
970073107 4:12185171-12185193 CTTATTAAACATTTATTTTATGG + Intergenic
971277507 4:25211969-25211991 CCTATAAAAGATTTATTTCAAGG - Intronic
971865584 4:32166452-32166474 CTCATTCAGCATCTATTTCTTGG + Intergenic
972742390 4:41900175-41900197 CATATTAAGCAAATATCTCAGGG + Intergenic
972956038 4:44392624-44392646 CTTATTAAGCATCTTTTTTATGG - Intronic
974334999 4:60531182-60531204 GCTCTTTAGCATCTCTTTCAAGG + Intergenic
975604662 4:76142348-76142370 CTTATTAAACATGAATTTCAAGG - Intronic
979370907 4:119884970-119884992 AAAATTAAGCCTCTATTTCATGG - Intergenic
980599041 4:134995101-134995123 CCTATTAAGTATTATTTTCAAGG + Intergenic
980854831 4:138426744-138426766 CCTATTACGTATCTCTATCAGGG - Intergenic
980941922 4:139282985-139283007 CCTGATAAGCATATTTTTCATGG + Intronic
981360608 4:143841334-143841356 CCTTTTAAGCACTTATTTTAAGG + Intergenic
981380451 4:144065598-144065620 CCTTTTAAGCACTTATTTTAAGG + Intergenic
984160532 4:176247264-176247286 CCTATAAATCATTTATTTGAAGG - Intronic
984525328 4:180851410-180851432 TCTCTTAAGCATCTGTTTCAGGG + Intergenic
987516313 5:18915333-18915355 CCTAATAAGCATCTTTTCCTAGG + Intergenic
987624940 5:20386981-20387003 CCAATTAAGTATCTAACTCATGG - Intronic
988177566 5:27746036-27746058 TCTCTTAAGCATCTATTGTAAGG - Intergenic
989291377 5:39769914-39769936 ATTATTAATCAGCTATTTCAGGG - Intergenic
990739768 5:58900584-58900606 CCTAGTATGCATTTAATTCATGG - Intergenic
991234033 5:64373330-64373352 CCTATTAAGCTTCTGTTTTAAGG - Intergenic
993307330 5:86289104-86289126 CCTGTGAAGCTTCTATCTCAAGG - Intergenic
994539139 5:101072484-101072506 CATATGAAATATCTATTTCATGG + Intergenic
995377947 5:111498969-111498991 CTTGTTTAGCATGTATTTCAGGG + Exonic
996755133 5:126927314-126927336 CCTATTCTCCATCCATTTCATGG - Intronic
998628983 5:143877676-143877698 CTTATTAAGATTATATTTCAAGG + Intergenic
998726284 5:145018592-145018614 GTTATTAAACATCTACTTCATGG - Intergenic
998964756 5:147527173-147527195 CATATTGAGTATCTATTTTATGG - Intergenic
999798720 5:155012728-155012750 CTTATTAATGATTTATTTCATGG + Intergenic
999822421 5:155241201-155241223 TTTATGGAGCATCTATTTCATGG - Intergenic
1000526028 5:162358708-162358730 CTTTTTAAGCATCTATTGAAAGG + Intergenic
1002832692 6:837235-837257 CATTTTATGCATCTTTTTCAGGG + Intergenic
1003584736 6:7377205-7377227 ACTTTTAGGCATCTATTACATGG - Intronic
1004207854 6:13609120-13609142 TCTATTAAGGATATATTTCCAGG - Intronic
1005392226 6:25345218-25345240 CCTGTAAAGAATGTATTTCATGG - Intronic
1007022187 6:38532024-38532046 CCTCTTTAGCACCTCTTTCAGGG - Intronic
1007057197 6:38898523-38898545 CCTATTAAGCCTTTATTTTCTGG - Intronic
1008473557 6:51911253-51911275 CCTATTAAGCATCTATTTCAGGG - Intronic
1008970297 6:57359362-57359384 CCTTTTAAGCATCCCTGTCACGG + Intronic
1009159265 6:60261186-60261208 CCTTTTAAGCATCCCTGTCAAGG + Intergenic
1009877824 6:69528258-69528280 CCTAGGAAACATCTAGTTCATGG + Intergenic
1014554011 6:122823589-122823611 TCTAGTAAGCATCCATTTTAAGG + Intergenic
1014624057 6:123704373-123704395 CCTAGTAAGCATCTGTGTCAGGG + Intergenic
1014818609 6:125960709-125960731 CCTATTCAGCATATATTCCATGG - Intronic
1015454638 6:133412713-133412735 CCTATTCAGCATAGATCTCATGG + Intronic
1016396909 6:143633657-143633679 CATATTAATTATTTATTTCATGG + Intronic
1020707974 7:11569661-11569683 ACTATTGAGCATCTATCTGAAGG + Intronic
1021044544 7:15906606-15906628 CCTCTTGAGCATCAACTTCAAGG - Intergenic
1024306699 7:47935347-47935369 CCTGTGTAGCATCCATTTCAGGG - Intronic
1026277062 7:68889267-68889289 CCTATTAAGCAATTATGACAGGG - Intergenic
1027969228 7:85057273-85057295 CCTATTACGCATCTGTTACCTGG - Intronic
1028927825 7:96378977-96378999 ATTATTAAGCATGTATTTAATGG - Intergenic
1030319154 7:108146112-108146134 CCTACTAAGCATCCCTATCACGG - Intergenic
1034130562 7:148712280-148712302 TCTGTTAAACATGTATTTCATGG + Intronic
1035708170 8:1692762-1692784 TGTATTAATCATCTAGTTCATGG - Intronic
1036964236 8:13278099-13278121 CCCATTGAGCATGTACTTCATGG + Intronic
1038069208 8:23994820-23994842 CCTATTATACCTCTCTTTCAAGG - Intergenic
1038379993 8:27083963-27083985 GCTATTAAGCATCTATGTTTTGG + Intergenic
1041533520 8:58898867-58898889 TGTATTAAGCATCTATTAAACGG + Intronic
1043588310 8:81795195-81795217 CCTATTATGTATGTATTCCAGGG - Intergenic
1045446869 8:102275652-102275674 CCTGATAAGCATGTATTTCAGGG - Intronic
1046284560 8:112078064-112078086 CCTTTTAAGCATTTCTTGCAGGG + Intergenic
1048030872 8:130630846-130630868 TTTATAAAGCATATATTTCAGGG - Intergenic
1051574865 9:18603739-18603761 CCTTTTAAGTATATACTTCAGGG + Intronic
1055752016 9:79517046-79517068 ATTATTAAGAATCTATTTCAAGG - Intergenic
1055893608 9:81149837-81149859 CTTCTTAAGGATCTATTTCCTGG + Intergenic
1056056766 9:82832757-82832779 CTTATTAAGCATTTATTTTGGGG + Intergenic
1056130819 9:83584827-83584849 CCTATTATCGATCCATTTCACGG - Intergenic
1056683457 9:88740126-88740148 CTTAGTAACCATGTATTTCAAGG - Intergenic
1058015132 9:100023116-100023138 TCTATTATGCATCTGCTTCAAGG - Intronic
1058871603 9:109206757-109206779 CCTTTCAAACATCTATTTTATGG + Intronic
1188314002 X:28651487-28651509 CCTAATAATCATCTAGGTCAGGG - Intronic
1188431584 X:30109597-30109619 CTTACTAAGCAACTATTACATGG - Intergenic
1189548146 X:42065029-42065051 CCTATCAAGTATTTCTTTCATGG + Intergenic
1192889064 X:75368750-75368772 CCTACTAACAATCTATTTCCTGG + Exonic
1193094924 X:77537237-77537259 GCTACTAAGCATCTACTTCATGG + Intronic
1195853827 X:109309713-109309735 CCAATTAAGCCCCTATTTCATGG - Intergenic
1198539853 X:137626462-137626484 TCTATTTAGTATCAATTTCAGGG + Intergenic
1199283793 X:146034051-146034073 CCTATTATGAACCCATTTCAGGG + Intergenic
1199578858 X:149341521-149341543 TCTATTAAGCCTCTACTTCCAGG + Intergenic
1199714013 X:150493039-150493061 CCTATTACTCCTCTCTTTCATGG - Intronic
1200796472 Y:7345674-7345696 CCTAATTAGAATCTATTTCTGGG + Intergenic