ID: 1008481691

View in Genome Browser
Species Human (GRCh38)
Location 6:51992874-51992896
Sequence CCTTCAGTATTGCTGGTACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 85}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008481688_1008481691 2 Left 1008481688 6:51992849-51992871 CCAGCTCTGGGTTAAGAAGGTAC 0: 1
1: 0
2: 0
3: 4
4: 85
Right 1008481691 6:51992874-51992896 CCTTCAGTATTGCTGGTACAAGG 0: 1
1: 0
2: 0
3: 8
4: 85
1008481686_1008481691 7 Left 1008481686 6:51992844-51992866 CCATTCCAGCTCTGGGTTAAGAA 0: 1
1: 0
2: 0
3: 16
4: 169
Right 1008481691 6:51992874-51992896 CCTTCAGTATTGCTGGTACAAGG 0: 1
1: 0
2: 0
3: 8
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008481691 Original CRISPR CCTTCAGTATTGCTGGTACA AGG Intronic
910474510 1:87592215-87592237 CCTTCAGTTTTCCTGGTACTGGG - Intergenic
911352686 1:96773674-96773696 CCTTTAGAATTTCTGGTACCAGG + Intronic
914448698 1:147772102-147772124 CCTTCAGTTTTGCTGGTTCCAGG + Intronic
918258299 1:182770329-182770351 CCTCCAGCATTGCTGGGATATGG + Intergenic
918330140 1:183451385-183451407 GCTTGAGAATTGCTGGTATAAGG + Intergenic
921398253 1:214692068-214692090 CCTTCAGTATGGAAGATACATGG + Intergenic
1064586837 10:16847622-16847644 TCTCCAGTGATGCTGGTACAGGG + Intronic
1065024752 10:21529719-21529741 CTTTCAGTATTGCTGCATCATGG + Intergenic
1067817718 10:49495169-49495191 CCTTCAGTCTTGCTGGGAGTTGG + Intronic
1068133670 10:52927598-52927620 ACTTCAGTAGTGATGGTACCAGG + Intergenic
1078563282 11:12391437-12391459 CTTTCAGTATTACTGGTTCTGGG + Intronic
1080277060 11:30514418-30514440 CTTTCAGTATTCCTCTTACATGG - Intronic
1083283901 11:61645346-61645368 GCCTCAGCTTTGCTGGTACAAGG + Intergenic
1084999189 11:73013972-73013994 TGTTCAGTGTTGCTGGTATAAGG - Intronic
1088305203 11:108400214-108400236 TCTTCAGGATGGATGGTACAAGG + Intronic
1100822764 12:98447184-98447206 CCTTCAGTGTGGCTGGTACCAGG - Intergenic
1105522850 13:21146602-21146624 CCAGCAGTAAGGCTGGTACATGG + Intronic
1107200465 13:37709813-37709835 CATTCAGAATTTCTGGTACAAGG + Intronic
1108126922 13:47254764-47254786 TCTTCAGTATTCCTTGAACATGG - Intergenic
1109874083 13:68375575-68375597 CCTTCAGTGCTGCTAGTATATGG + Intergenic
1111155338 13:84314270-84314292 CCTGCAGTATTCCTGGCACCAGG - Intergenic
1113828735 13:113277546-113277568 CCTTCACTATTGTTGATACTGGG - Intergenic
1116940514 14:50786083-50786105 CCTTTGGTACTGCTGGTCCAAGG + Intronic
1119138696 14:72245058-72245080 CGTTTAGAATTGCTGGAACATGG - Intronic
1125777300 15:42228221-42228243 ACCTCACTATTCCTGGTACAAGG + Intronic
1129107157 15:73318332-73318354 CTGTCTGAATTGCTGGTACATGG + Intergenic
1130008757 15:80129946-80129968 CCTTCAGTATGGCTGAATCATGG + Intronic
1131997001 15:98142841-98142863 CTTTCAGTCTTACTGGGACAGGG - Intergenic
1134370423 16:13619055-13619077 GCTTCTTCATTGCTGGTACAAGG - Intergenic
1141207091 16:81940918-81940940 CCTTTAGTATTTCTGATGCATGG + Intronic
1146017134 17:29242855-29242877 CCTACTGAATTGCTAGTACATGG - Intergenic
1155079606 18:22395532-22395554 CCTTCAGTAAGGATGGTAGAAGG - Intergenic
1160105125 18:75966514-75966536 TCTTCAGTTTTACTGGCACAAGG + Intergenic
1161896187 19:7082734-7082756 CCATCATGAGTGCTGGTACATGG - Intronic
1168095008 19:54109502-54109524 GCTCCAGTTTTGCTGGTACAGGG + Intronic
926883525 2:17575170-17575192 CCTTCTGGATTGCAGGTACTGGG + Intronic
930110338 2:47673578-47673600 CCTTAAGTATTGCTTCTTCAAGG - Intergenic
930699019 2:54440507-54440529 CATTTGGCATTGCTGGTACAGGG - Intergenic
934034783 2:88079869-88079891 TGTTTAGAATTGCTGGTACATGG - Intronic
935182012 2:100700022-100700044 ACTCCAGTATTGCTGGTTTAGGG - Intergenic
942004713 2:171686432-171686454 CCATCACCATTGCTGGCACATGG + Intergenic
943379983 2:187132871-187132893 AGTCCAGTATTGCTGGAACATGG + Intergenic
944121909 2:196249635-196249657 CCTTCAGGAATCCTGGTAGAAGG + Intronic
945095917 2:206218998-206219020 ACTTGAGAATTGCTGGCACATGG - Intergenic
947202296 2:227625024-227625046 TATTTAGAATTGCTGGTACATGG - Intronic
947292597 2:228593659-228593681 CCTTCAGCATTTCTGGTTCCTGG + Intergenic
1173112387 20:40204420-40204442 TGATCAGTATTGCTGGAACAGGG - Intergenic
1177587754 21:23120192-23120214 CCTCCAGTGTTGCAGGTACTGGG + Intergenic
1178490643 21:33048928-33048950 CCTTCAGCTTTGCTAGGACAAGG + Intergenic
1181892286 22:26074088-26074110 TCTCCAGTATTGCTGGTCCCAGG - Intergenic
1182297174 22:29316395-29316417 CCTCCAGCCTTGCTGGGACAGGG - Intronic
956942960 3:74185195-74185217 GCTTCAGGAATGATGGTACATGG - Intergenic
964418319 3:156473216-156473238 CCTTCAGAATTGCTGCTCCTGGG - Intronic
965259849 3:166468029-166468051 ACTTCAGTATGGCAGGAACATGG - Intergenic
967100747 3:186213566-186213588 TCTTCAGTGCTGCTGGTCCAGGG + Intronic
969407069 4:7000577-7000599 CCTTCAGCTCTGCTGGGACACGG - Intronic
971737683 4:30477516-30477538 TATTTAGAATTGCTGGTACATGG + Intergenic
973018510 4:45171172-45171194 CCTTCAGTACTGCTCTTTCAGGG + Intergenic
974603723 4:64122474-64122496 CCTGCAGTAGTGTTAGTACAAGG + Intergenic
975725387 4:77286578-77286600 CTTGCAGCATTGCTGGTACCTGG + Intronic
981117345 4:141007165-141007187 CTTTCAGTATTTCTGGTATGTGG - Intronic
985838293 5:2286966-2286988 CCATAAGTATTTCTGTTACAAGG + Intergenic
986086523 5:4456960-4456982 CCTGAATTATTGCTGTTACAGGG - Intergenic
987290690 5:16505635-16505657 CCTTCAGGACAGCTGGAACAGGG + Intronic
988782593 5:34536666-34536688 TCTAGAGTAGTGCTGGTACATGG + Intergenic
988961198 5:36373331-36373353 CCTTCAGTCTTGATTGCACATGG - Intergenic
989427450 5:41313033-41313055 CCTTCAATATTACTGATGCATGG + Exonic
990172343 5:53067020-53067042 AATTCAGTAATGCTGGTACTGGG + Intronic
998885592 5:146690804-146690826 CCTTCTGTACTGAAGGTACAGGG - Intronic
999371875 5:151060650-151060672 CCTACAGTGCTGCTGGTTCAAGG - Intronic
1002527933 5:179825359-179825381 CCTTTAGTAGTGCTGGACCACGG + Intronic
1008453731 6:51684065-51684087 CTTTCAGAATAGCTGGAACATGG - Intronic
1008481691 6:51992874-51992896 CCTTCAGTATTGCTGGTACAAGG + Intronic
1010381556 6:75231486-75231508 CCTCCAGAATTGCTGCTTCAGGG + Intergenic
1011290524 6:85772350-85772372 CCTGCAGTAGTGTTGATACAAGG + Intergenic
1014090762 6:117401275-117401297 CTTTCAGTATGGCTGATGCATGG - Intronic
1014790638 6:125668171-125668193 CCTTCAGTGTTGGAAGTACAAGG - Intergenic
1024944815 7:54797977-54797999 CCTTCAGTATGCCTGGGACAGGG - Intergenic
1025173711 7:56784726-56784748 CTTTGAGTATTACTGCTACATGG + Intergenic
1025698387 7:63793427-63793449 CTTTGAGTATTACTGCTACATGG - Intergenic
1030088263 7:105835783-105835805 CCTTCAGTATTTCTGTTAATAGG - Intronic
1036107498 8:5856585-5856607 CCCTCAGTCCTGCTGTTACAGGG - Intergenic
1038853785 8:31308402-31308424 TCTTCTGTTTTGCTGATACAAGG - Intergenic
1041866921 8:62584585-62584607 CATTCAGTGTGGCTGGCACAAGG - Intronic
1042867309 8:73367261-73367283 CCCCCAGTATTCCTGTTACACGG - Intergenic
1048908002 8:139106874-139106896 CCTTCAGTAGTGAAGGCACATGG - Intergenic
1050119402 9:2292915-2292937 CACTCAGTCTTCCTGGTACATGG - Intergenic
1050187394 9:2988603-2988625 CTTTCAGTTTTGGTGGTAAAAGG - Intergenic
1051315496 9:15825835-15825857 AGTTCAGTATTGGTGGTAGAGGG + Intronic
1052805441 9:33009343-33009365 AGTTCAATATTGCTGGTACAAGG - Intronic
1055838595 9:80475299-80475321 TGTTTAGAATTGCTGGTACATGG - Intergenic
1060048340 9:120358748-120358770 CCTACAGTGTTGGTGGTACAGGG - Intergenic
1187225375 X:17371246-17371268 CCTTTAGTTTTGCTGGCTCATGG - Intergenic
1198982156 X:142410355-142410377 CCTTCAGTATTTCTTGTAGTAGG - Intergenic