ID: 1008482096

View in Genome Browser
Species Human (GRCh38)
Location 6:51996289-51996311
Sequence ATGAGCCACCGCTCCCAGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008482093_1008482096 0 Left 1008482093 6:51996266-51996288 CCCAAAGTGCTGGGATTACAGGC 0: 215700
1: 270647
2: 186590
3: 142154
4: 223611
Right 1008482096 6:51996289-51996311 ATGAGCCACCGCTCCCAGTTGGG No data
1008482086_1008482096 13 Left 1008482086 6:51996253-51996275 CCCGCCTCAGCCTCCCAAAGTGC 0: 59629
1: 175979
2: 229415
3: 270535
4: 297068
Right 1008482096 6:51996289-51996311 ATGAGCCACCGCTCCCAGTTGGG No data
1008482085_1008482096 16 Left 1008482085 6:51996250-51996272 CCTCCCGCCTCAGCCTCCCAAAG 0: 20304
1: 108143
2: 164903
3: 177131
4: 137557
Right 1008482096 6:51996289-51996311 ATGAGCCACCGCTCCCAGTTGGG No data
1008482094_1008482096 -1 Left 1008482094 6:51996267-51996289 CCAAAGTGCTGGGATTACAGGCA 0: 89533
1: 228199
2: 240322
3: 214910
4: 187714
Right 1008482096 6:51996289-51996311 ATGAGCCACCGCTCCCAGTTGGG No data
1008482083_1008482096 30 Left 1008482083 6:51996236-51996258 CCTGACCTCATGATCCTCCCGCC 0: 241
1: 10318
2: 46177
3: 66840
4: 54712
Right 1008482096 6:51996289-51996311 ATGAGCCACCGCTCCCAGTTGGG No data
1008482091_1008482096 3 Left 1008482091 6:51996263-51996285 CCTCCCAAAGTGCTGGGATTACA 0: 288135
1: 266162
2: 155564
3: 133776
4: 191789
Right 1008482096 6:51996289-51996311 ATGAGCCACCGCTCCCAGTTGGG No data
1008482087_1008482096 12 Left 1008482087 6:51996254-51996276 CCGCCTCAGCCTCCCAAAGTGCT 0: 60215
1: 147830
2: 155736
3: 113395
4: 79914
Right 1008482096 6:51996289-51996311 ATGAGCCACCGCTCCCAGTTGGG No data
1008482084_1008482096 25 Left 1008482084 6:51996241-51996263 CCTCATGATCCTCCCGCCTCAGC 0: 71
1: 2480
2: 18259
3: 50963
4: 68224
Right 1008482096 6:51996289-51996311 ATGAGCCACCGCTCCCAGTTGGG No data
1008482089_1008482096 9 Left 1008482089 6:51996257-51996279 CCTCAGCCTCCCAAAGTGCTGGG 0: 84188
1: 205795
2: 234195
3: 260821
4: 298692
Right 1008482096 6:51996289-51996311 ATGAGCCACCGCTCCCAGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008482096 Original CRISPR ATGAGCCACCGCTCCCAGTT GGG Intronic
No off target data available for this crispr