ID: 1008483871

View in Genome Browser
Species Human (GRCh38)
Location 6:52014554-52014576
Sequence CTGGATAAACAGATGGATCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 281
Summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 259}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008483871 Original CRISPR CTGGATAAACAGATGGATCA TGG Intronic
900081512 1:861845-861867 GTAGATAAATAGATGGATGATGG + Intergenic
900081528 1:862059-862081 GTAGATAAATAGATGGATGATGG + Intergenic
900485769 1:2921986-2922008 CTGGATAGACAGATGGACAGAGG - Intergenic
900829787 1:4957808-4957830 CTGGAAATACAGTTGCATCATGG + Intergenic
902741064 1:18438345-18438367 AGGGTTAAACACATGGATCAAGG - Intergenic
906929634 1:50156439-50156461 CTGGGCCAACAGATGGATAAAGG + Intronic
907040650 1:51256208-51256230 AGGGATGAACAGATGGAACACGG - Intronic
907774266 1:57498029-57498051 ATGGATGAATGGATGGATCAAGG + Intronic
909107645 1:71432717-71432739 CTGGATGAATTGTTGGATCAAGG - Intronic
909366247 1:74826222-74826244 TTAGATAAACTTATGGATCATGG - Intergenic
913545725 1:119867312-119867334 CTGAATAAATAGATAGTTCAGGG + Intergenic
915174126 1:154000617-154000639 CTGGACAAAGAGATGATTCATGG + Intronic
916648684 1:166815386-166815408 ATGGATTAACCGATTGATCAGGG + Intergenic
916681363 1:167108155-167108177 CTGGATGAATGGATGGACCATGG - Intronic
918502431 1:185212351-185212373 CAGGAAAAACAGATGGAAGATGG - Intronic
918937207 1:190937089-190937111 CTGTAGAAATAGCTGGATCATGG + Intergenic
920700584 1:208215517-208215539 GTGGATAAAGAGATGGATGAAGG + Intronic
922403104 1:225281282-225281304 CTGGCTTTACAGATGGATAAAGG - Intronic
922790589 1:228308825-228308847 GTGGATAAATAGATGGATTGTGG - Intronic
922933062 1:229404915-229404937 CTGGATAAACAGAAGTATTATGG + Intergenic
923125925 1:231034437-231034459 CTGGAGAAGCACATGAATCAAGG - Intronic
924272033 1:242343919-242343941 CTGAATAAACAAATGGACAATGG + Intronic
1066712636 10:38252211-38252233 CTGAATAAACAAATGGACAATGG - Intergenic
1067051489 10:43024059-43024081 ATGGATAAATGGATGGATGATGG + Intergenic
1069961249 10:72080695-72080717 CTGGATAAACAGAAGGAGACAGG + Intronic
1070266930 10:74912318-74912340 ATGGATAGACAGATAGATGAAGG + Intronic
1071411420 10:85400495-85400517 CAGAATAAACAGAAGGACCATGG + Intergenic
1071477144 10:86034790-86034812 CTGGATGAACAGATGTATGATGG + Intronic
1072475929 10:95759690-95759712 TTGGATAAACAGTTTGCTCACGG + Intronic
1074297900 10:112208092-112208114 CAGGATAACCACATGCATCAGGG + Intronic
1074363434 10:112840018-112840040 CTGGATACACAAATGGAGGAGGG + Intergenic
1075487027 10:122830768-122830790 CTGGATAGAGAGATGGCTGAAGG + Intergenic
1076676720 10:132150900-132150922 ATGGATAAATGGATGGATTAAGG - Intronic
1076825118 10:132963339-132963361 GTTGATAGACAGATGGATGAAGG - Intergenic
1078044700 11:7903145-7903167 CTGGAAAAACAGATAGCTAAGGG - Intergenic
1080447121 11:32347562-32347584 CTTGATTAAGAGATGGGTCAGGG + Intergenic
1081246931 11:40778649-40778671 CTGGCTAAATAGATTGATCAAGG + Intronic
1084658808 11:70535373-70535395 CTGGTTAGACTGATGGATGATGG - Intronic
1087347496 11:96990342-96990364 GTGAAAAAACAGATGGATCAGGG + Intergenic
1088035633 11:105310621-105310643 CTGAATAGAAAGATGGAACAGGG - Intergenic
1088556759 11:111069791-111069813 CTTGGTAAGCAGATTGATCATGG + Intergenic
1091000505 11:131906984-131907006 CTGGATAAAGAGATGCCTCTAGG - Intronic
1091516758 12:1191937-1191959 CTGAATAAACAGTAGAATCATGG + Intronic
1092865028 12:12752886-12752908 CTGGCTAAACAGATAGAGAAGGG - Intronic
1093852827 12:24061464-24061486 CTGGATAATCATTTGGATTATGG - Intergenic
1095197116 12:39332970-39332992 CTGTCGAAACAGATGCATCAAGG - Exonic
1095857180 12:46873184-46873206 CTGAATAAACAAATAGATGAAGG + Intergenic
1096611227 12:52803312-52803334 ATGGATGAATAGATGGATGATGG + Intergenic
1098990373 12:77059299-77059321 CAGGACAGACAGATGGAGCAAGG - Intronic
1099160593 12:79236721-79236743 ATGGATAAACAGCTTGATGATGG + Intronic
1100323565 12:93519775-93519797 CTGGATAAACACAAGGATTAGGG - Intergenic
1101225639 12:102685645-102685667 CTGGGTAAACTGATTGTTCATGG + Intergenic
1104034722 12:125090357-125090379 ATGGATGAATAGATGGATGACGG - Intronic
1105035147 12:132914058-132914080 AAGGATAAACACATAGATCATGG - Intronic
1106057219 13:26249694-26249716 ATGAATGAACAGATGGATAATGG - Intergenic
1106736410 13:32592089-32592111 CAGGATAAGCAGATGGTACAAGG - Intronic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1106879254 13:34111537-34111559 TTGGATAAACAAAAGGATCTGGG - Intergenic
1107596472 13:41968050-41968072 GAGGATAAATACATGGATCAAGG - Intergenic
1108440514 13:50448461-50448483 CTGAATATACAAATGGATGACGG + Intronic
1110593808 13:77295449-77295471 CTTGAGACACAGATGGATCCGGG - Intronic
1111975754 13:94965700-94965722 TTGGGTACACAGATGTATCAAGG + Intergenic
1112354252 13:98660991-98661013 CTGAATATACAGATGGCTCGTGG - Intergenic
1113128548 13:107008395-107008417 CTGAATATAAAGATGGATTATGG + Intergenic
1113984555 13:114303452-114303474 CTGTATACACAGATGGAGCATGG - Intronic
1114662902 14:24360021-24360043 CTGAATATACAGATGGAAAATGG + Intergenic
1114889243 14:26896082-26896104 CTGGATATCCAGCTGGAGCAAGG + Intergenic
1117504657 14:56390078-56390100 CTACATAGACAGAAGGATCAAGG - Intergenic
1118752663 14:68817977-68817999 TTGGAGAAACAGCTGGATCCTGG - Intergenic
1122877508 14:104675641-104675663 ATGGATGGACAGATGGATAATGG + Intergenic
1124425863 15:29562075-29562097 GAGGATAATCAGATGGATCCAGG + Intronic
1130980788 15:88810575-88810597 CTGCATATCCAGATGGCTCAGGG + Intronic
1131768975 15:95714254-95714276 CTGGAGAAAAAGATGGGTCCTGG + Intergenic
1132516375 16:367984-368006 ATGGATAAACAGAGGGAATAGGG + Intronic
1133563022 16:6967216-6967238 ATGTATAAACAAATGGATGATGG - Intronic
1133598541 16:7316834-7316856 CTGGAAAAACAAAGGGACCAGGG + Intronic
1141178356 16:81735318-81735340 ATGGATAGATAGATGGATGATGG + Intergenic
1141619786 16:85231001-85231023 ATGGATGGACAGATGGATGATGG + Intergenic
1141619820 16:85231182-85231204 ATGGATGGACAGATGGATGATGG + Intergenic
1141619847 16:85231335-85231357 ATGGATGGACAGATGGATGATGG + Intergenic
1146626877 17:34441706-34441728 CTGGATGGACAGATGGATGGAGG + Intergenic
1146968353 17:37052256-37052278 CTGGAGAATCTGATGGAACAAGG + Intronic
1147977503 17:44256183-44256205 ATGGATGAATAGATGGATAATGG - Intronic
1150915207 17:69429787-69429809 CAGGATAATCTGATGGATGATGG - Intronic
1152986233 18:323950-323972 CTGGAAAAACAAATGGAGAAAGG - Intronic
1153532341 18:6060207-6060229 CTGGATAACCACATAGCTCAAGG - Intronic
1154505650 18:15038245-15038267 CTTGAGAAACAGAAGGACCAAGG - Intergenic
1157855629 18:51102509-51102531 CTGGATAAAGACCTGTATCAAGG + Intergenic
1158119695 18:54035234-54035256 CTGTATAAACAGAGATATCATGG + Intergenic
1158251987 18:55499501-55499523 CTACATAAACAGATGGAGCTAGG - Intronic
1158323452 18:56289054-56289076 AAGGATAAACAGATGGGTCAAGG + Intergenic
1158901201 18:61963349-61963371 CTGGTTAAACAGATGAAAAAAGG + Intergenic
1159840668 18:73394949-73394971 CTGGCTTTACAGATGGATGAAGG - Intergenic
1160055488 18:75475570-75475592 CTCTATAAACAGATGAATCCTGG - Intergenic
1160502568 18:79409552-79409574 AGGGATAAAGAGATGGATTATGG - Intronic
1161258563 19:3323091-3323113 GTGGATAGATAGATGGATAAAGG + Intergenic
1161498931 19:4602660-4602682 GTGGATAAATATATGGATTATGG + Intergenic
1161633119 19:5369343-5369365 GTGGATGAATAGATGGATGATGG - Intergenic
1161841020 19:6680341-6680363 GTGGAGAAACTGAAGGATCAAGG + Intronic
1162595201 19:11623269-11623291 CTGGAAAAACAGATAGAAAAGGG - Intergenic
1164073505 19:21791387-21791409 CTGGAAAAACAGATAGAAAAGGG - Intergenic
1165413367 19:35676033-35676055 ATGGATAGACAGATGGAGCAGGG - Intronic
1165470358 19:35999881-35999903 CTTGTTTAACAGATGGGTCAAGG - Intergenic
1165678237 19:37747008-37747030 CTCAAAAAACAGAAGGATCAGGG + Intronic
1166342340 19:42146222-42146244 CTGGAGACACAGATGGAACCAGG + Intronic
1167192976 19:48004589-48004611 CTGGAGGAACAGATGGAGGAGGG - Intronic
1167233755 19:48301637-48301659 ATGGATGAACAGATGGATGTGGG + Intronic
1167233818 19:48301943-48301965 CTGGATAGATAGATGGATATGGG + Intronic
1167233864 19:48302196-48302218 CTGGATAGATAGATGGATATGGG + Intronic
1167565092 19:50251011-50251033 CTGGATACACAGATCAAACATGG + Intronic
1167808630 19:51809015-51809037 CTGGAAAAACAGATAGAAAAGGG - Intronic
1167882849 19:52476477-52476499 CTGGAAAAACAGATAGAAAAGGG - Intronic
1168070413 19:53947204-53947226 ATTGATAAACAGATGGAACCAGG - Intergenic
1168190339 19:54733823-54733845 ATGGAGATACAGATAGATCATGG + Intronic
1168202680 19:54827923-54827945 GTGGAAATACAGATAGATCATGG + Intronic
1168207483 19:54861953-54861975 GTGGAGATACAGATAGATCATGG + Intronic
1168360118 19:55732484-55732506 TTGGATACACAGATGCATGAAGG + Exonic
925745358 2:7039144-7039166 ATGGATAGAGAGATGGATGATGG + Intronic
926069723 2:9877330-9877352 CTGGAAAAGGAGCTGGATCAAGG - Intronic
926577680 2:14600348-14600370 CTGGATTAACAGATGGATCCTGG + Intergenic
926706226 2:15839667-15839689 CAGGATAAACAAATGGTGCATGG + Intergenic
927061319 2:19424946-19424968 CTGGATATACAGATGGAGACTGG - Intergenic
930858480 2:56044385-56044407 CTGGACAGACAGCTGGGTCAGGG + Intergenic
931072063 2:58663068-58663090 ATGGATAGAAAGATGGATCTTGG + Intergenic
931095434 2:58934967-58934989 CTGAATAATCAAATGAATCAAGG + Intergenic
932493476 2:72135351-72135373 CTGGATCACCAGCTGGATCTTGG + Exonic
937494618 2:122404677-122404699 CAGGATAAGTAGATGGAGCAAGG - Intergenic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
938929486 2:136074194-136074216 CTGGAAAAACAGATAGAAAAGGG - Intergenic
939165788 2:138639952-138639974 ATGGAAAAACAAATGGATCTGGG + Intergenic
940488832 2:154330594-154330616 CTGGATAATCAGAAGGAGCAGGG - Intronic
944895733 2:204162179-204162201 CTGTAAAAACATCTGGATCAGGG - Intergenic
946156320 2:217809104-217809126 ATGGAGATACAGATGGATGAAGG + Intronic
946469805 2:219947965-219947987 CTGGATATAGAGATGGATTGTGG + Intergenic
1169374544 20:5055903-5055925 CAGGATAATCAGTTGGATCTGGG + Intergenic
1170268148 20:14491633-14491655 CTGGTTAAACAGATGGGCCTTGG + Intronic
1171853189 20:30322815-30322837 CAGGATAAAAAGATGCTTCAAGG + Intergenic
1172017332 20:31885470-31885492 CTGGATAAACATATGGAAAATGG + Intronic
1172179914 20:32996607-32996629 TTGGAAGAACAGATGGATAAGGG - Intronic
1173022597 20:39279663-39279685 ATAAATAAACAGATGGAGCATGG + Intergenic
1175504788 20:59473953-59473975 CTGAATATACAAATGGACCATGG - Intergenic
1175770498 20:61620398-61620420 ATGGATAGATAGATGGATGATGG + Intronic
1175770505 20:61620469-61620491 ATGGATAGATAGATGGATGATGG + Intronic
1175817253 20:61889719-61889741 ATGGACAGACAGATGGATGATGG + Intronic
1176792211 21:13330871-13330893 CTTGAGAAACAGAAGGACCAAGG + Intergenic
1177378471 21:20305363-20305385 CTAGATAAACAAATGGACAATGG - Intergenic
1177991606 21:28041735-28041757 CTTGAGAAACAGAAGGACCAAGG + Intergenic
1179623705 21:42635164-42635186 GTGGATGAACAGATGGACAATGG - Intergenic
1181958982 22:26609478-26609500 ATGGATAAAGGGATGGATGAAGG + Intronic
1182483653 22:30626437-30626459 CTGCAGAAACAGATTGAGCAAGG - Intronic
1182740443 22:32563608-32563630 CTGGAAAAGTTGATGGATCAGGG + Intronic
1184144310 22:42599882-42599904 CTGGAGAAACAAAGGGACCAAGG + Intronic
950623603 3:14227512-14227534 CTGGAAAAACAGATAGAAAAGGG + Intergenic
952463177 3:33551340-33551362 CTGGCCAAACAGATGGATCCAGG - Exonic
954172317 3:48814616-48814638 CTGGAAATACAAATGGAACAAGG - Intronic
954901291 3:54022204-54022226 CAGGATAGACAGAGGGAACAGGG + Intergenic
954998550 3:54904713-54904735 CTGGATAAATACATGATTCAAGG + Intronic
955709724 3:61765672-61765694 CTTGACAAAAAGCTGGATCACGG - Intronic
957443178 3:80279744-80279766 TTTGATAAACATATGTATCAGGG + Intergenic
957791808 3:84951367-84951389 TTGGATAAAGAAATGGATAAAGG + Intergenic
958551052 3:95613226-95613248 GTGGAAAAACAGATGAATAAAGG + Intergenic
959363094 3:105419965-105419987 CTGGATATATAGATGGAAGACGG + Intronic
959629165 3:108489088-108489110 CTGGATTAAAAAATGGATAAAGG - Intronic
959926525 3:111927772-111927794 CTTGATAAACAGATGGTTCAAGG - Intronic
960169968 3:114448452-114448474 GAGGGCAAACAGATGGATCAAGG + Intronic
962389748 3:134961254-134961276 CTGGAGAACCTGATGGAGCATGG + Intronic
965041098 3:163507985-163508007 CTGGAGAAACAGGTGGGTCTGGG + Intergenic
965165978 3:165194959-165194981 CTGGACAAACAAATGGCTCTGGG - Intronic
965733014 3:171792422-171792444 CTGGGAATGCAGATGGATCAGGG + Intronic
967546553 3:190736896-190736918 CTGCAAATTCAGATGGATCATGG - Intergenic
969239532 4:5889448-5889470 CTGGAGCAACATCTGGATCATGG - Intronic
969612280 4:8234121-8234143 ATGGATAAATGGATGGATGATGG - Intronic
970311004 4:14782481-14782503 ATGGATAAACAGATGAATATAGG + Intergenic
972822589 4:42718807-42718829 CTGGGAAAACAGATGTTTCAGGG + Intergenic
974753056 4:66166404-66166426 CTGGACAAAAAGATGATTCAAGG - Intergenic
975401339 4:73943294-73943316 GTGAATAATTAGATGGATCAGGG - Intergenic
977141766 4:93382353-93382375 GTGGACAAACAGATGCATTATGG - Intronic
978240872 4:106514856-106514878 ATGGATAGATAGATGGATGATGG + Intergenic
979398989 4:120224497-120224519 CTGGACAAACAGATGGGGCGGGG - Intergenic
980403153 4:132320162-132320184 GGGGATGAACAGATGGATCTGGG + Intergenic
981340875 4:143619977-143619999 CTGAATATACAGATGGAAAATGG + Intronic
986072880 5:4304434-4304456 CTGGATGAATAGATGGATGATGG - Intergenic
986399474 5:7366417-7366439 ATGGATATACAGATGGAAAAGGG - Intergenic
987063615 5:14266322-14266344 CTGGGTAGAAAGATGGATGAAGG - Intronic
987812825 5:22860201-22860223 CTGGATGTACAGTTGTATCATGG - Intergenic
987949032 5:24652379-24652401 CTGAAAAAACAGATGGAAAAGGG + Intergenic
988730599 5:33969102-33969124 ATTGATAAACAAATGGGTCAAGG - Intronic
988823367 5:34910231-34910253 CTGGGTAACGAGATGGACCATGG - Intronic
992150302 5:73895975-73895997 TCTGATAAACAGATGGATGAGGG - Intronic
993182282 5:84569849-84569871 CTGGATAAACAAATGTGGCATGG - Intergenic
994521144 5:100837530-100837552 CAGAATAAACATATGGTTCAAGG - Intronic
994717886 5:103345960-103345982 ATGCAAAAACAGATGGATAATGG - Intergenic
997653457 5:135538535-135538557 CTCAAAAAACAGATGGAACAAGG - Intergenic
997890146 5:137668847-137668869 ATGAATCAACAGATGAATCAGGG + Intronic
999524166 5:152384212-152384234 ATGGATAGATAGATGGATGATGG - Intergenic
999927543 5:156395587-156395609 CTGAATATACAAATGGATGATGG - Intronic
1000846612 5:166289568-166289590 CAGGATATACAGATGAATAAGGG + Intergenic
1002689235 5:181038716-181038738 CTGCATAAACAGTAGGATCAGGG - Intergenic
1002819944 6:715599-715621 ATGCATAAACAGATGGAAAATGG + Intergenic
1003776731 6:9375198-9375220 CTGTATAAACACATGCACCATGG + Intergenic
1005414162 6:25583546-25583568 CTGGAGACATAGATGGATGAAGG + Intronic
1006228787 6:32564302-32564324 CTGGAAAAACAGATAGAAAAGGG - Intronic
1007919962 6:45598091-45598113 CTGGTAAAACACATGTATCATGG - Intronic
1008483859 6:52014482-52014504 CTGGATAGATGGATGGATCATGG + Intronic
1008483871 6:52014554-52014576 CTGGATAAACAGATGGATCATGG + Intronic
1008483883 6:52014618-52014640 CTGGATAAATGGATGGATCATGG + Intronic
1008483911 6:52014771-52014793 CTGGATAGATGGATGGATCATGG + Intronic
1013018204 6:106180660-106180682 TTGAATAAACAGATGAATCGTGG + Intergenic
1013078552 6:106792227-106792249 CTGGATAAACAGATGCACAGGGG + Intergenic
1013690477 6:112636262-112636284 GTGGTTTAAAAGATGGATCACGG - Intergenic
1014097697 6:117478640-117478662 CTAGATAAAAAGAAGGCTCAGGG - Intronic
1015123374 6:129725414-129725436 AAGGATAAACAGATGAATCCAGG - Intergenic
1015352334 6:132235969-132235991 CTGGATGAAAAGGTAGATCAAGG - Intergenic
1015998836 6:139022171-139022193 AAGGATAAACATATAGATCATGG - Intergenic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1017233479 6:152096566-152096588 ATGGATGAACAAATGGCTCATGG + Intronic
1019479979 7:1261893-1261915 ATGGATAGATAGATGGATGATGG - Intergenic
1019567286 7:1690608-1690630 ATGGATAAATGGATGGATGAAGG + Intronic
1020396362 7:7722894-7722916 CTGGCAAAAAAGATTGATCAGGG - Intronic
1020723293 7:11776705-11776727 CTGGATAAACTGATAAAACATGG + Intronic
1021285345 7:18774671-18774693 CTGGATAAAGCGTTGGCTCAAGG + Intronic
1021773086 7:24024757-24024779 CAGGCTGAACAGATGGAACACGG - Intergenic
1022309005 7:29177621-29177643 ATAGATAAACAGATGGAAGAAGG - Intronic
1023649297 7:42351828-42351850 CTGAATAAAAAGATGGTTCTGGG + Intergenic
1025120088 7:56294529-56294551 ATGGAGAGACAGATGGATAAAGG + Intergenic
1027112883 7:75454768-75454790 ATGGATAAAGAGATGGCACACGG + Intronic
1027285129 7:76639379-76639401 ATGGATAAAGAGATGGCACACGG + Intergenic
1027611145 7:80362214-80362236 CTGCATAAACAGCTGGCTCTTGG - Intergenic
1030377376 7:108769529-108769551 ATGGAGAAAAAAATGGATCAGGG + Intergenic
1030394940 7:108974257-108974279 CTGGCTAAGCAGATGGACTATGG + Intergenic
1030447362 7:109663954-109663976 CTGGATATACAGATAGATTCTGG + Intergenic
1030886189 7:114940914-114940936 CTGGATAACAAGATGGAATAGGG - Intronic
1035279104 7:157766116-157766138 ATGGATAAGTAGATGGATGATGG - Intronic
1035523739 8:295488-295510 GTAGATAAATAGATGGATGATGG - Intergenic
1037422949 8:18723592-18723614 CTGGAGATACAGAAGGAACAGGG - Intronic
1041587146 8:59534637-59534659 CTGGATAAACAGCTGATTCTAGG - Intergenic
1043285559 8:78525151-78525173 CTGGGTAAACAGATGGTGCATGG - Intronic
1043918091 8:85947941-85947963 CTTGATAAATAGATGGGTTAGGG - Intergenic
1044347321 8:91120445-91120467 CTGGATAAAGAGGTGGTTCCAGG + Intronic
1044953460 8:97455802-97455824 ATGGATAAATAGATGAATAAAGG - Intergenic
1045937686 8:107700413-107700435 ATGGATCAACAGATGGATGATGG + Intergenic
1046793468 8:118346033-118346055 CAGAATAAACAGATGCACCAAGG - Intronic
1047424007 8:124729102-124729124 CTCGATAGACTGATGGATCGTGG - Intergenic
1047921525 8:129639596-129639618 CTACATAATCAGATGGCTCATGG + Intergenic
1048894256 8:138975278-138975300 CTGAATACACAGATGGACAATGG - Intergenic
1049177706 8:141204348-141204370 CTGGATAAACGTATGGAAAAGGG + Intergenic
1050265109 9:3881668-3881690 ATGGGTGAACAGATGGATGATGG - Intronic
1053339403 9:37310171-37310193 AAGGATAAAAAGATGGCTCAAGG + Intronic
1054154165 9:61628658-61628680 CAGGATAAAAAGATGATTCAAGG - Intergenic
1054749211 9:68887163-68887185 GTGGAGAAAAAAATGGATCATGG - Intronic
1054969312 9:71066827-71066849 CTAGATAAAAAGAGGGAACAGGG - Intronic
1056329257 9:85508470-85508492 CTGAAATAACAGATGGAACAGGG + Intergenic
1057082630 9:92184424-92184446 ATGGATAAATGGATGGATAATGG - Intergenic
1057741908 9:97719414-97719436 CTGGATAAAAAGATGAAGAAAGG + Intergenic
1059252200 9:112895688-112895710 ATGAATAGACAGATGGATGATGG - Intergenic
1059728008 9:117028202-117028224 GTGAATAAACAGAAGGTTCAAGG + Intronic
1060170322 9:121456040-121456062 CTGGATGAACCGCTGCATCAAGG + Intergenic
1062205470 9:135334385-135334407 TTGGATAAATGGATGGATGATGG + Intergenic
1062205489 9:135334505-135334527 TTGGATAAATGGATGGATGATGG + Intergenic
1062520725 9:136956815-136956837 ATGGATAAATGGATGGATGAAGG + Intronic
1185481875 X:452319-452341 GTGGATAAATAGATAGATAATGG - Intergenic
1185497532 X:566589-566611 ATGGATAAATGGATGGATGATGG + Intergenic
1185547110 X:954450-954472 CTGGATGAATGGATGGATGAGGG - Intergenic
1185633070 X:1530082-1530104 ATGGATACATAGATGGATGACGG - Intronic
1185958693 X:4521730-4521752 ATAGATACATAGATGGATCATGG + Intergenic
1186697411 X:12051749-12051771 TTGAATAAACAGATGGATGGAGG - Intergenic
1187010917 X:15278398-15278420 CTGGACAATCAGATGGATTCTGG + Intergenic
1187060101 X:15778495-15778517 ATGGATAAAGAGATCAATCAAGG + Intronic
1187722804 X:22169639-22169661 CTGGAGGAACAGAGGCATCAGGG + Intronic
1187777103 X:22772890-22772912 GTGGAGGAACAGAGGGATCATGG + Intergenic
1191669361 X:63734986-63735008 CTGGCTCAACAGATGGGTGAAGG - Intronic
1191707366 X:64107797-64107819 CTGGATAAACACATGGAATGTGG - Intergenic
1193899782 X:87163101-87163123 CTGAATAAATAGGTGGATCCAGG - Intergenic
1194280261 X:91943114-91943136 GAGGATAAACAGTTGGAACATGG + Intronic
1195014141 X:100761940-100761962 ATGGATCAAAAGATGGCTCATGG - Intergenic
1197130040 X:122994828-122994850 CTGGTAAATCAGATGGGTCAGGG - Intergenic
1197427052 X:126310087-126310109 CTGGATAAACTACTGAATCATGG + Intergenic
1198954521 X:142113260-142113282 ATGGATGAATAGATGGAACACGG - Intergenic
1199006982 X:142711307-142711329 AGGGATAAATAGGTGGATCACGG + Intergenic
1199641369 X:149865723-149865745 TTGGATAAACAATTGCATCAAGG - Intergenic
1200597738 Y:5166608-5166630 GAGGATAAACAGTTGGAACATGG + Intronic