ID: 1008488770

View in Genome Browser
Species Human (GRCh38)
Location 6:52063774-52063796
Sequence CCGAGGGGCAACATTGCCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008488761_1008488770 22 Left 1008488761 6:52063729-52063751 CCGGTCTAACAGCCAAACATGTT No data
Right 1008488770 6:52063774-52063796 CCGAGGGGCAACATTGCCCCTGG No data
1008488762_1008488770 10 Left 1008488762 6:52063741-52063763 CCAAACATGTTTCTACACATTGC 0: 1
1: 1
2: 13
3: 141
4: 743
Right 1008488770 6:52063774-52063796 CCGAGGGGCAACATTGCCCCTGG No data
1008488760_1008488770 28 Left 1008488760 6:52063723-52063745 CCACTTCCGGTCTAACAGCCAAA 0: 1
1: 0
2: 0
3: 6
4: 73
Right 1008488770 6:52063774-52063796 CCGAGGGGCAACATTGCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008488770 Original CRISPR CCGAGGGGCAACATTGCCCC TGG Intronic