ID: 1008489091

View in Genome Browser
Species Human (GRCh38)
Location 6:52066654-52066676
Sequence AGGCCGAAGCGAGTGGCAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008489088_1008489091 -10 Left 1008489088 6:52066641-52066663 CCAGAACTTTGGGAGGCCGAAGC 0: 43
1: 4046
2: 98802
3: 230406
4: 227873
Right 1008489091 6:52066654-52066676 AGGCCGAAGCGAGTGGCAGGTGG No data
1008489085_1008489091 -1 Left 1008489085 6:52066632-52066654 CCTGTAATCCCAGAACTTTGGGA 0: 5675
1: 301637
2: 263655
3: 146484
4: 128687
Right 1008489091 6:52066654-52066676 AGGCCGAAGCGAGTGGCAGGTGG No data
1008489087_1008489091 -9 Left 1008489087 6:52066640-52066662 CCCAGAACTTTGGGAGGCCGAAG 0: 88
1: 6701
2: 146298
3: 293303
4: 204811
Right 1008489091 6:52066654-52066676 AGGCCGAAGCGAGTGGCAGGTGG No data
1008489082_1008489091 15 Left 1008489082 6:52066616-52066638 CCTACAGTGACTCAGGCCTGTAA 0: 1
1: 1
2: 29
3: 119
4: 316
Right 1008489091 6:52066654-52066676 AGGCCGAAGCGAGTGGCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008489091 Original CRISPR AGGCCGAAGCGAGTGGCAGG TGG Intronic
No off target data available for this crispr