ID: 1008489645

View in Genome Browser
Species Human (GRCh38)
Location 6:52072806-52072828
Sequence CTGAGCATTTATAAGGTAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 189}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008489645 Original CRISPR CTGAGCATTTATAAGGTAGA AGG (reversed) Intronic
901745059 1:11367004-11367026 CTGAGCACTTAAAATGTAGCTGG - Intergenic
903726119 1:25446586-25446608 CAGAGCATTTAAAATGCAGATGG + Intronic
907821212 1:57971431-57971453 CTGAAAAATTATAAGGTACATGG + Intronic
908208145 1:61872152-61872174 CTGAGCAGTTAAAAAGAAGAAGG - Intronic
910285120 1:85545180-85545202 ATGAGCCTTTCTAAGGCAGAGGG + Intronic
910329576 1:86055682-86055704 ATGAGCATTCTTAAGGTATAGGG - Intronic
916986998 1:170202335-170202357 CAGAGCATTGAAAAGGCAGAGGG - Intergenic
917613081 1:176709744-176709766 CTGTACTTTTATAATGTAGATGG + Intronic
919232623 1:194793974-194793996 TTGAGCATCTATAATGTATAAGG - Intergenic
921095620 1:211884945-211884967 ATGAGCATTCAGAAGGTGGAGGG - Intergenic
922556976 1:226540016-226540038 CTGAGCATTTAGATGCTACAAGG - Intergenic
1064913617 10:20431556-20431578 CAGAGTATTTATAGGGTACAGGG + Intergenic
1065124725 10:22563167-22563189 GTGAGCATTTTTAATATAGAAGG + Intronic
1068031061 10:51705617-51705639 CTGAGCACTTAGTAGGGAGAAGG + Intronic
1069596125 10:69672033-69672055 CTGTGCCTTCACAAGGTAGAAGG + Intergenic
1069965002 10:72107514-72107536 GTGAGTATTTTTAAAGTAGATGG - Intronic
1071488735 10:86121680-86121702 CTGAGCACTTAGAATGTACAAGG + Intronic
1073061622 10:100736935-100736957 CTGAATATTTATACGGTCGAGGG - Intronic
1074698089 10:116068939-116068961 CTGAGACTTTGTAAGGTATAAGG + Intronic
1076396648 10:130143178-130143200 ATGAGGATTTCGAAGGTAGAAGG - Intronic
1080191644 11:29557366-29557388 CTGAGTATTGATAAGGTATCTGG - Intergenic
1081234016 11:40623881-40623903 GTGAGTTTTTATAATGTAGAGGG - Intronic
1081302403 11:41468288-41468310 CTGGGTATTTATAAGGGAAAGGG - Intergenic
1081457167 11:43235216-43235238 CTGAGCATTTATATGAGAGGAGG + Intergenic
1082275767 11:50219673-50219695 CAAAATATTTATAAGGTAGATGG - Intergenic
1085569786 11:77549457-77549479 CTGAGAATTTAGAATTTAGAAGG + Intronic
1086594145 11:88551192-88551214 ATGAGCATTTATGATGTAGCAGG - Intronic
1088931900 11:114360255-114360277 CTGAGAATATATAAGGCTGATGG + Intergenic
1089451382 11:118599841-118599863 CTAAGCATTTACAGGGGAGACGG - Intronic
1090231214 11:125105595-125105617 CTCAACAGTTATATGGTAGATGG + Intronic
1094668998 12:32550367-32550389 CTGAGTTTTTAAAAAGTAGATGG + Intronic
1096558709 12:52420303-52420325 CTTAGCATTGAAAAGGAAGAAGG - Intergenic
1096807806 12:54151007-54151029 CTGAGCTTTGATGTGGTAGAGGG - Intergenic
1096936001 12:55277267-55277289 CTGATAATTTATAAGGAAAAAGG + Intergenic
1097555900 12:61137216-61137238 TTGATCATTTATATTGTAGATGG - Intergenic
1098127148 12:67309650-67309672 CTCAGCACTTATAATGCAGAGGG - Intronic
1100067005 12:90661255-90661277 CTGAGAATGGATAAGCTAGATGG + Intergenic
1101662189 12:106775321-106775343 CAGAGTGTTTATAGGGTAGATGG + Intronic
1107008448 13:35642432-35642454 ATGAGCATGTATAATGTATATGG - Intronic
1108331354 13:49387955-49387977 CTGAGCACTTATAATGTACTAGG + Intronic
1108927043 13:55763390-55763412 CTGTTCATTTGTAATGTAGAAGG - Intergenic
1111394677 13:87649757-87649779 CTGGGCATAGATAAGGTGGATGG - Intergenic
1112604812 13:100894037-100894059 CTTAGCATTTCTAAGGCAGATGG - Intergenic
1113065507 13:106370286-106370308 CTGGCCATTTATAAGGCATATGG - Intergenic
1113490197 13:110685584-110685606 CTGAGAATTTATGATCTAGATGG + Intronic
1114312819 14:21483432-21483454 GTGAGCATTTTTAAGGTAGAAGG - Intronic
1114775029 14:25472238-25472260 CTGAGCACTTACTATGTAGAAGG - Intergenic
1115406680 14:33025152-33025174 CTGAGATTTTAGAAAGTAGAAGG + Intronic
1117539112 14:56729474-56729496 CTGGGAAATTCTAAGGTAGAAGG + Intronic
1120106442 14:80500982-80501004 CTGAGCACTTAGAAGCAAGATGG - Intronic
1120829040 14:88981946-88981968 GGGAGCACTTATAAGGTAGGAGG + Intergenic
1121831251 14:97054235-97054257 CAGAGCCTTTATAAAGTAGCTGG - Intergenic
1122459369 14:101882643-101882665 CAGGGCATTTGTAAGGCAGAAGG + Intronic
1126724468 15:51617435-51617457 CAGAGCATTTATGAAGTAGTGGG - Intronic
1127316968 15:57805930-57805952 CTGAGGATTTATAAAGTAGAAGG - Intergenic
1127692173 15:61408041-61408063 CTGAGCATCAATAAGAAAGAAGG - Intergenic
1128565291 15:68697053-68697075 CTAAGCATTTATTAGGTACCAGG - Intronic
1130745536 15:86649669-86649691 CTGTGCATTAAAAAGATAGAAGG - Intronic
1131775430 15:95791566-95791588 CTGATCATATATAATGTACAGGG - Intergenic
1131840034 15:96427251-96427273 TTGACCTTTTCTAAGGTAGACGG + Intergenic
1132620414 16:864520-864542 CTGAGCACGTTTAAGGTAGTAGG + Intronic
1137607005 16:49793591-49793613 ATGGGCATTTGTAAGGTAGGTGG + Intronic
1139072315 16:63397896-63397918 CTGAGCATTTATAGTGTACTAGG + Intergenic
1139620709 16:68139316-68139338 CTGAGCATTTACAATGTGCAAGG - Intronic
1141452000 16:84110581-84110603 CTGAGCATTTATGATGTAGCAGG + Intronic
1145071472 17:19812480-19812502 CTGAGTATGTTTAAGGTAGCTGG - Intronic
1145749583 17:27345651-27345673 CTGATCTTTTATTATGTAGATGG + Intergenic
1148434411 17:47671320-47671342 CTGAACAATTCTAAGGTAGGTGG - Intronic
1149005239 17:51798224-51798246 CTGAGCTTCTATAAGGAAGGAGG - Intronic
1149912941 17:60582832-60582854 CATAGAATTTATAAGGGAGATGG - Intronic
1151194777 17:72423744-72423766 CTAAGGCTTTATCAGGTAGAAGG + Intergenic
1152825899 17:82464619-82464641 CTGAGCATTATTAAGGGAGCAGG - Intronic
1158093243 18:53740043-53740065 CATACCATTTATAAGGTAGAAGG + Intergenic
1160089920 18:75817258-75817280 CTGAGAATTTAGAGAGTAGATGG - Intergenic
1162852956 19:13445515-13445537 CTGAGCATTTATTATGTGAAAGG + Intronic
925671210 2:6311603-6311625 CTGAGGATTTATGATGTGGAAGG + Intergenic
929020922 2:37552342-37552364 CACAGCATTTACAAGGTAGCTGG - Intergenic
935211194 2:100940513-100940535 CTGAGCACTTACAATGTAGCAGG + Intronic
937175878 2:119934490-119934512 CTCAGCATTTATAAAATAAAGGG - Intronic
938729912 2:134139228-134139250 TTTAGCATTTATAAGAAAGACGG + Intronic
940701681 2:157052550-157052572 CTGAGCATTTAAGAGCTATAAGG + Intergenic
941433218 2:165436374-165436396 CTTGGCATTTATAAGGGAGTTGG + Intergenic
943662015 2:190569178-190569200 CTGTGCATTTATAACTTAGATGG + Intergenic
943850480 2:192715522-192715544 CTGAGCATTAATAGGATAAATGG - Intergenic
944477550 2:200123039-200123061 CTGGGCCTTTATAAGATATATGG - Intergenic
945063354 2:205927325-205927347 CAAAGCATTTACAAAGTAGATGG + Intergenic
946493051 2:220168559-220168581 CTGAGCACTTATCATGTAGAAGG - Intergenic
947924979 2:233913459-233913481 CTGTTCATTTGTAAGCTAGAGGG + Intergenic
948753193 2:240144202-240144224 CTGGGCATTTATAAAGGACAGGG + Intronic
948770230 2:240248056-240248078 AAGAGCATTTATAAGGTGGCTGG - Intergenic
948941264 2:241197957-241197979 CTAAGCCTTAATAAGGAAGAGGG - Intronic
1169751641 20:9000604-9000626 CTGAGGAGGTATAAGGCAGAAGG - Intergenic
1170534568 20:17327273-17327295 CACAGCATTTACAAGGGAGATGG - Intronic
1172301233 20:33851994-33852016 ATGAGCATTAATTAGGTAGGAGG + Intronic
1173356038 20:42291549-42291571 CTGTGCATGTGTAAGGGAGATGG + Intronic
1174597880 20:51699007-51699029 CTGAACATTTGTAAGTTACATGG - Intronic
1177625470 21:23654418-23654440 CTGAGCATTTGGAAAGTAGCTGG - Intergenic
1178694672 21:34782486-34782508 TAGAGCATTCATAAGGTAGCAGG + Intergenic
1185183257 22:49376221-49376243 CTTTGCATTTCTAAAGTAGATGG - Intergenic
951460579 3:22947076-22947098 ATGTGCATTTATATGGAAGATGG - Intergenic
951499843 3:23373007-23373029 CCCAGCATTTATAAGATAAAAGG - Intronic
954461202 3:50627981-50628003 CTGAGCAGATATGAGATAGAAGG + Intronic
957283599 3:78186294-78186316 CTGAGCTTTGATGAGGTACATGG - Intergenic
959134541 3:102400511-102400533 CTGAGCATGGAGAAGGCAGAGGG - Intronic
959562945 3:107803258-107803280 CTAACCATTTATTAGGTTGATGG - Intronic
960130414 3:114050161-114050183 TTGAGCATTTATAAGATCGTGGG - Intronic
960163282 3:114373537-114373559 GTGGGCATTTGTAAAGTAGAAGG - Intronic
960449927 3:117794152-117794174 CTGAACACTTAAAAGGGAGAGGG + Intergenic
961121385 3:124374143-124374165 CTGTGTCTTTATATGGTAGAAGG - Intronic
965015878 3:163156023-163156045 CTGAGTATTGCTAAGGAAGAAGG + Intergenic
966186356 3:177230517-177230539 CTGAGGATTTAGAAGTTAAACGG - Intergenic
966584001 3:181601463-181601485 CTGAGCACATATAAGATAGTAGG + Intergenic
966770618 3:183500576-183500598 GTGAGCATTCATAAGGTATGAGG + Intronic
967082033 3:186058635-186058657 ATGAGCAATTATAAGGTTTAAGG + Intronic
967680983 3:192363584-192363606 CTGAACATATATAATATAGATGG + Intronic
968426008 4:523762-523784 CTGAGCACTTCGGAGGTAGAGGG - Exonic
971759025 4:30740175-30740197 CTGTGCATATATGAAGTAGAGGG + Intronic
972131520 4:35841018-35841040 TTGAGAATTTATAAGTAAGAAGG - Intergenic
972706594 4:41550392-41550414 CAGAGCATTTTGAAAGTAGAAGG - Intronic
973332873 4:48927455-48927477 CTGAGCATTTATTAGGCATCAGG + Intergenic
977392034 4:96423608-96423630 CTGAGTCTTTATATGGTGGAAGG - Intergenic
977439258 4:97041507-97041529 TTGGGTATTTATAAGGTAAATGG - Intergenic
977561882 4:98541111-98541133 CTGAGCACCAACAAGGTAGATGG - Intronic
977592022 4:98837305-98837327 GTGTGCATATATAAGGAAGAAGG + Intergenic
981057766 4:140383398-140383420 CTGCCCATTTATAATGTAGTTGG + Exonic
981218750 4:142206072-142206094 CTGTGCTTTTACATGGTAGAAGG + Intronic
984153175 4:176160166-176160188 TTGAGCATGTAGAAGGGAGAAGG + Intronic
984410027 4:179386186-179386208 CTGAGCATCTTCAAGGAAGAGGG - Intergenic
985926146 5:3020651-3020673 CTAAGCTTTTATCATGTAGATGG - Intergenic
987355605 5:17060996-17061018 CTGAGCATTTATGAGGTGCCTGG + Intergenic
990161748 5:52948626-52948648 CTGATCCCTTATAAAGTAGAAGG - Intronic
990549320 5:56857659-56857681 CTGAGCATTTGAAATGTAGTTGG - Intronic
992670779 5:79058788-79058810 CTGACAATTAATAAGATAGAAGG + Intronic
993336471 5:86665712-86665734 GTGAGCCATTAGAAGGTAGAAGG - Intergenic
994001214 5:94781972-94781994 GTGAGGATTTATAATATAGATGG + Intronic
996148027 5:119998985-119999007 CTAAGCATTTATAATGTATGAGG + Intergenic
998429625 5:142059859-142059881 CTTAGAGTTAATAAGGTAGAAGG + Intergenic
998953137 5:147412052-147412074 TTGATCATTTGTAAGGAAGAAGG - Intronic
1000368975 5:160516980-160517002 CCGAGCAATTTTAAGGTTGAAGG - Intergenic
1008489645 6:52072806-52072828 CTGAGCATTTATAAGGTAGAAGG - Intronic
1008713848 6:54264274-54264296 ATGAGCATATATGATGTAGATGG - Intronic
1011245573 6:85318032-85318054 CTGAGGCTGTATAAGGTAGTAGG - Intergenic
1012062360 6:94504830-94504852 GTGAGAGTGTATAAGGTAGATGG + Intergenic
1012618265 6:101304670-101304692 CTGATCATTTATATTGGAGATGG - Intergenic
1013958932 6:115874282-115874304 CTGAGCATTTTTTATGTGGAAGG + Intergenic
1014599842 6:123397414-123397436 CAGAGAATTTATAGGGTAGTAGG - Intronic
1015704368 6:136072116-136072138 TTGAGCATTTATTATGTAGCAGG + Intronic
1016564064 6:145432467-145432489 CTGATCATTTACAATGTAGCTGG - Intergenic
1017083663 6:150693448-150693470 CTGATCATTCAAAGGGTAGAAGG - Intronic
1017840021 6:158214149-158214171 CAGATCAATTATAAGGTAAATGG + Intergenic
1018158416 6:161012424-161012446 CAGAGAATTTATAAGCTAGTTGG + Intronic
1018212990 6:161500218-161500240 CTGTGCATGTATAGGGGAGAGGG - Intronic
1018620336 6:165724725-165724747 ATGATCAGTAATAAGGTAGAAGG + Intronic
1018986830 6:168644052-168644074 ATGAGCATTTACTATGTAGAAGG + Intronic
1019446752 7:1075187-1075209 CTGAGCAATGACAAGCTAGACGG + Intronic
1021540481 7:21751753-21751775 CTGAGCAATTCTAGGTTAGAAGG + Intronic
1022158000 7:27679814-27679836 CTGAGCACTTGAAAGGTAGCTGG - Intergenic
1024134176 7:46389814-46389836 TTGAGCATTTATAAATTAAATGG + Intergenic
1024270420 7:47637333-47637355 CTCATCATTTAGAAGATAGAGGG - Intergenic
1024319167 7:48048167-48048189 CTGAGTATTTAACAGGTAGAGGG + Intronic
1024496630 7:50055743-50055765 CTGAGCACTTATGAGGTACCAGG - Intronic
1025836497 7:65099069-65099091 TTGAGCATTTTTAGGGGAGAAGG + Intergenic
1025906264 7:65788499-65788521 TTGAGCATTTTTAGGGGAGAAGG + Intergenic
1026769240 7:73183854-73183876 TTGAGCGTTTTTAAGGGAGAAGG + Intergenic
1027010109 7:74737237-74737259 TTGAGCGTTTTTAAGGGAGAAGG + Intronic
1027077932 7:75208798-75208820 TTGAGCGTTTTTAAGGGAGAAGG - Intergenic
1027991376 7:85366204-85366226 CTGAGCTTTTATTTGATAGAAGG + Intergenic
1028107110 7:86891673-86891695 CTGGGTGTTTATAAAGTAGAGGG - Intronic
1031022344 7:116641828-116641850 CTGAACATTTATAAGGCACATGG - Intergenic
1031545201 7:123044015-123044037 TTGAACATGTATATGGTAGATGG - Intergenic
1032244654 7:130199619-130199641 CTTTGTATTTATAAGTTAGAGGG - Intronic
1032781563 7:135168635-135168657 TTGAGCTTTTAGAAGGTGGAGGG - Intronic
1038867894 8:31459443-31459465 CTTATTATTTATAAGGCAGATGG + Intergenic
1044122666 8:88416600-88416622 CTGAGCATGTATTTGGTGGAAGG + Intergenic
1044389302 8:91630067-91630089 CTCAGCACTTAGAATGTAGAAGG + Intergenic
1044582824 8:93839122-93839144 CTGAGCAGTAAAAAGCTAGAAGG - Intergenic
1044741587 8:95332699-95332721 CTGAGCACTTAAAAGGTACCTGG - Intergenic
1045829032 8:106435772-106435794 CTGAGCCTTGAGAAGATAGAGGG - Intronic
1045835173 8:106511991-106512013 TTGAGCATTTATAATGTATCAGG - Intronic
1045862041 8:106824445-106824467 CTGAGCTGTGATATGGTAGATGG - Intergenic
1047445609 8:124916399-124916421 CTGAGTAATTAAAGGGTAGAAGG - Intergenic
1047738168 8:127784715-127784737 CTGGGCATTTTAAAGGGAGAAGG + Intergenic
1048006603 8:130424649-130424671 CTGAGCATCTACCAGGTAGCAGG + Intronic
1048971077 8:139645274-139645296 CTGAGCCTTTAGAAGGTGAAGGG - Intronic
1050132759 9:2429593-2429615 CTCAGCATTTAGATGGTAGAGGG + Intergenic
1050144051 9:2546637-2546659 CTGAGGATTTATAAGTAAGGGGG + Intergenic
1052597931 9:30585514-30585536 TTAATCATTTATAAGGTATAAGG - Intergenic
1053106870 9:35416890-35416912 CTGAGGTTTTATCAGGCAGAAGG - Intergenic
1056217459 9:84418608-84418630 ATGAGCATTTATTAGGCAGTTGG + Intergenic
1186954453 X:14666665-14666687 TTGAGCATTTACAAGGTACCAGG + Intronic
1187303739 X:18076448-18076470 CTGAGCAAGTATAAGATATATGG - Intergenic
1188396775 X:29694661-29694683 CTGTGTTCTTATAAGGTAGAAGG + Intronic
1191654441 X:63580829-63580851 TTGAGCTTTTTGAAGGTAGAAGG + Intergenic
1194637996 X:96369021-96369043 CTAAGCATTTATAAAGTCTACGG + Intergenic
1195666892 X:107439975-107439997 CTGAGCCTTTATCAGGTGCAAGG - Intergenic
1196125817 X:112097673-112097695 CTGGGCATTTATTAGGGAAATGG - Intergenic
1196595233 X:117538333-117538355 CAGAGCATTAGTAAGGTATACGG - Intergenic
1198135880 X:133749891-133749913 CTGGGCATTTATGAGGGCGAGGG - Intronic
1199368679 X:147019718-147019740 CTGAGGATTTAGAAGGCTGAAGG + Intergenic
1200878218 Y:8182342-8182364 CAGATGATTTATAAGGAAGATGG + Intergenic