ID: 1008490214

View in Genome Browser
Species Human (GRCh38)
Location 6:52078529-52078551
Sequence GTGTCTCTTTGTTTTGGGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1304
Summary {0: 1, 1: 0, 2: 2, 3: 81, 4: 1220}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008490214_1008490217 -2 Left 1008490214 6:52078529-52078551 CCAGTCCCAAAACAAAGAGACAC 0: 1
1: 0
2: 2
3: 81
4: 1220
Right 1008490217 6:52078550-52078572 ACGCCGTGTTTTATTTAGCCTGG No data
1008490214_1008490221 26 Left 1008490214 6:52078529-52078551 CCAGTCCCAAAACAAAGAGACAC 0: 1
1: 0
2: 2
3: 81
4: 1220
Right 1008490221 6:52078578-52078600 CTCTCATTAACTGCATCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008490214 Original CRISPR GTGTCTCTTTGTTTTGGGAC TGG (reversed) Intronic