ID: 1008494465

View in Genome Browser
Species Human (GRCh38)
Location 6:52118598-52118620
Sequence CATACCTATCACCTTTGACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008494461_1008494465 15 Left 1008494461 6:52118560-52118582 CCTTCTATTTCTCTATGTCTACT No data
Right 1008494465 6:52118598-52118620 CATACCTATCACCTTTGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008494465 Original CRISPR CATACCTATCACCTTTGACC TGG Intergenic
No off target data available for this crispr