ID: 1008499839

View in Genome Browser
Species Human (GRCh38)
Location 6:52169987-52170009
Sequence CCTCATGCAGAGTCTCTACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008499839_1008499849 19 Left 1008499839 6:52169987-52170009 CCCAGTAGAGACTCTGCATGAGG No data
Right 1008499849 6:52170029-52170051 CTTCTCCACTGCCCCAGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008499839 Original CRISPR CCTCATGCAGAGTCTCTACT GGG (reversed) Intergenic
No off target data available for this crispr