ID: 1008501739

View in Genome Browser
Species Human (GRCh38)
Location 6:52190392-52190414
Sequence TCCAAAGGAAGCCTGAGTCT AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 165}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008501739 Original CRISPR TCCAAAGGAAGCCTGAGTCT AGG (reversed) Exonic
900828547 1:4947097-4947119 TGGAAATGAAGACTGAGTCTAGG - Intergenic
901143198 1:7048983-7049005 TCCTAAGTCGGCCTGAGTCTGGG - Intronic
902281035 1:15374666-15374688 CCCAAAGTGAGCCGGAGTCTGGG - Intronic
903113399 1:21157629-21157651 TACAAAAGAAACCTGAGGCTGGG - Intronic
903803578 1:25988377-25988399 CCCAAGGGCAGCCTGAGTATAGG + Intronic
904774475 1:32898304-32898326 CCCACAGGAGGCCTGAGTGTGGG - Exonic
905498990 1:38420913-38420935 TCCAAAGGAAGCCAGAGCAGCGG + Intergenic
912401356 1:109396594-109396616 TCCAAAGGGAGACTGAGGCTTGG + Intronic
912531076 1:110322898-110322920 TCCCAAGGCAGCTTGACTCTTGG + Intergenic
914172077 1:145234151-145234173 TCCAAGGCAAGCCTGATTCTAGG - Intergenic
915610256 1:156986248-156986270 TCAAAAGGGGCCCTGAGTCTTGG + Intronic
916707390 1:167365533-167365555 TCCAAGGAAAGCCTGCGCCTGGG - Exonic
918467760 1:184838788-184838810 TCCAAACCCAGCCTGAGTCAGGG - Intronic
918657390 1:187045465-187045487 GCCACAGGAAGACTGATTCTTGG - Intergenic
920920827 1:210295969-210295991 TCCAAAGGGAGCCTACGTCTGGG - Intergenic
921158126 1:212453704-212453726 TCCACAGGAAGCCAGGCTCTAGG + Intergenic
921763353 1:218941886-218941908 ACCAAAGGAAGCATGCCTCTAGG + Intergenic
1062927825 10:1330143-1330165 TCCCAAGGAGGGCTGAGTCAGGG + Intronic
1062938828 10:1406949-1406971 TCCCAAGGAAGGCTGCTTCTGGG - Intronic
1063367681 10:5500944-5500966 TCCAAGGGAAGCCGGAGGCTGGG + Intergenic
1070120247 10:73569250-73569272 TCCAGAGGAAGTCTGATTCATGG - Intronic
1071358698 10:84823226-84823248 TCCAAGGGAAGCCTTTGACTTGG + Intergenic
1072387734 10:94948861-94948883 TAAAAAGGAGGTCTGAGTCTAGG + Intronic
1073736958 10:106359370-106359392 TCCAAAGGAAAACTGAGTCTTGG - Intergenic
1076353500 10:129834799-129834821 ACCAAAAGAAGCATGTGTCTGGG + Intergenic
1078021107 11:7656573-7656595 TCCCAAGAAACCCTGAGTATTGG - Intronic
1080230855 11:30016831-30016853 TCCAGAGGAACCAGGAGTCTTGG - Exonic
1083096232 11:60254303-60254325 TCCCAAGTATGGCTGAGTCTGGG - Intergenic
1084747639 11:71183429-71183451 TCTAAAGCATGCCAGAGTCTTGG - Intronic
1085013009 11:73154379-73154401 TGAAAAGGAAGCCTGGCTCTGGG - Intergenic
1086174633 11:83875722-83875744 TATAAAAGAAACCTGAGTCTAGG + Intronic
1087232386 11:95681037-95681059 TTGAAAGGAATACTGAGTCTGGG - Intergenic
1088481170 11:110297072-110297094 ACCAAATGAAGCGTGAGACTTGG + Intergenic
1089650866 11:119911975-119911997 TCCAAATGACTCCTGTGTCTTGG + Intergenic
1089902707 11:122004653-122004675 TCCAAAAGAAGCCTCAGAGTTGG + Intergenic
1092114116 12:5986393-5986415 TCCAGAGGGAGACTGAGTCCTGG - Intronic
1092337983 12:7650814-7650836 TACGCAGGAAGCTTGAGTCTAGG - Intronic
1092829494 12:12429974-12429996 TCCAAGGAAAGCATAAGTCTAGG - Intronic
1093824334 12:23664875-23664897 TCCAAAGGAAGCCGGAGAAAGGG + Intronic
1095684381 12:45016100-45016122 TACAAATTAAGCCTGAGTCTAGG + Exonic
1096936620 12:55287066-55287088 TTCAAAAGAAGGTTGAGTCTTGG - Intergenic
1097496540 12:60345631-60345653 TACAAAAGTAGCCTAAGTCTGGG - Intergenic
1097878935 12:64669767-64669789 TGCACAGGAAGCCCGAGGCTGGG - Intronic
1098702444 12:73645908-73645930 CCCAAAGCTTGCCTGAGTCTGGG + Intergenic
1104363045 12:128152039-128152061 GACAGATGAAGCCTGAGTCTGGG + Intergenic
1105052065 12:133063596-133063618 TCCCAGGGCAGCCTGAGTCTGGG - Intergenic
1109178978 13:59190400-59190422 TTCAAAGGAAGCTTGATTCATGG + Intergenic
1117062889 14:51981052-51981074 TCCAAATGAAGGCTGCCTCTCGG + Intergenic
1123961067 15:25401425-25401447 ACCAAAGGAAGCCCAAGACTTGG - Intronic
1127232995 15:57016912-57016934 AGGAAAGGAAGCCTGAGTTTAGG - Intronic
1127459134 15:59182014-59182036 TCCATAAGACGCATGAGTCTGGG - Intronic
1128288806 15:66461007-66461029 TCTAATGGAAACCTGAGGCTGGG + Intronic
1128715283 15:69903406-69903428 TTAAGAGGAAGCCTGAGTCCAGG - Intergenic
1130542230 15:84828485-84828507 TCCAGAGGGAGCCTGGGCCTGGG - Intronic
1130612396 15:85373287-85373309 TCCCAAGAAAGCCTGAGCTTAGG + Intergenic
1132011718 15:98282216-98282238 GAGAAAGGCAGCCTGAGTCTGGG + Intergenic
1135939314 16:26807204-26807226 TCCCAAGGCAGCCAGACTCTTGG + Intergenic
1138383715 16:56621532-56621554 TCAGAAGGCAGCCTGAGCCTAGG + Intergenic
1138577836 16:57919879-57919901 TCCAGAGGAAGGCTGTATCTTGG - Intronic
1139265474 16:65634509-65634531 TCCACAGGAAGCCAGTTTCTGGG - Intergenic
1143039057 17:4018962-4018984 TCCAGAGGTAGGCAGAGTCTGGG - Intronic
1143960166 17:10710490-10710512 TGCAAAGGCAGCCTGAAACTGGG - Intronic
1144055512 17:11537219-11537241 TCCAAGGGGACCCTGAGTCAGGG + Intronic
1144605015 17:16657458-16657480 TCTAAAGAATGCCTGAGACTGGG + Intergenic
1146287079 17:31581332-31581354 TCCAAAGGAAGCCCGAGGGCTGG - Intergenic
1146599854 17:34204908-34204930 TCCCAAGGATGCCTAAATCTCGG - Intergenic
1146944843 17:36866665-36866687 GCCAGAGAAAGACTGAGTCTTGG - Intergenic
1146987140 17:37230710-37230732 CCCAAAAGAAGCCTGTCTCTAGG - Intronic
1148612018 17:48970950-48970972 TCCCTGGGAACCCTGAGTCTGGG + Intergenic
1148911877 17:50947229-50947251 TCCTGAGGAAGCATGAGCCTGGG - Intergenic
1150447743 17:65240615-65240637 TGCAATGGAAGCCTGCGACTTGG - Intergenic
1151868463 17:76820521-76820543 TCCAAGGGGAGACTGAATCTTGG - Intergenic
1152104763 17:78322583-78322605 TCCCAAGCAAGCCTGAGACCAGG - Intergenic
1153303160 18:3609341-3609363 TCCAAAGGAAGACTCAGGCCCGG - Intronic
1153546997 18:6218447-6218469 GCGAAAGGAAACCTGAGTGTAGG + Intronic
1155547338 18:26929085-26929107 TCCAAAGGAAGAGTGAGTATAGG - Intronic
1156034750 18:32753787-32753809 ACCAAAGGAAGCTTTAATCTGGG - Intronic
1159976812 18:74723594-74723616 GCCAAAGGAGCCCTGATTCTGGG - Intronic
1162339727 19:10085406-10085428 CCCAAAGCAAGACTAAGTCTGGG - Intergenic
1164753055 19:30670221-30670243 CTCAGAGGAAGCCTGAGGCTGGG - Intronic
1166644211 19:44519180-44519202 CCCAAAGGAAGCCTCCATCTGGG - Intronic
1168524444 19:57077661-57077683 TCCAAAGTTAACCTGAGGCTGGG + Intergenic
926345538 2:11941641-11941663 TCAAAAGGAATCCCGGGTCTGGG - Intergenic
926678260 2:15644929-15644951 GCCATCGGAAGCCTGAGTCTGGG - Intergenic
927743003 2:25589665-25589687 TGAAAAGGAAACCTGAGGCTGGG - Intronic
928069309 2:28198648-28198670 TACCAGGGAAGCCTGAGCCTGGG + Intronic
929448986 2:42024116-42024138 TAAAAAGGAACCCTGAGGCTGGG + Intergenic
931180192 2:59891747-59891769 TGCAAAGGAAGGCAGAGTCCTGG + Intergenic
931203820 2:60127546-60127568 TCCAACAGAAGTCTGAGTATGGG + Intergenic
932736579 2:74258905-74258927 GACAAAGGAAACCTGAGACTTGG - Intronic
932860264 2:75284491-75284513 TCCAGAGGAAGTCAGAGTGTTGG + Intergenic
933730956 2:85455970-85455992 AACAAAGGAAGCCTGAGAGTGGG + Intergenic
934754121 2:96813564-96813586 TTCCAAGGAAGCCTGAGACAAGG + Intergenic
935138897 2:100333589-100333611 TAAAAAGGAAGTCTGAGTCCTGG - Intergenic
936166856 2:110128357-110128379 GGCAAGGTAAGCCTGAGTCTCGG - Intronic
937657549 2:124393747-124393769 CCCAGAGAAAGCCTGAGCCTGGG - Intronic
942574935 2:177353371-177353393 TGGAAAAGAAGCCTGAGACTTGG - Intronic
942672022 2:178386249-178386271 TCCACAAGATGCCTGATTCTTGG - Intronic
1170541750 20:17396262-17396284 TACAATTGAAGCCTGATTCTTGG - Intronic
1170874472 20:20237293-20237315 TCGTAAGGTACCCTGAGTCTGGG - Intronic
1171955946 20:31463866-31463888 TCCAAAAAAAGACTGACTCTGGG + Intergenic
1174463680 20:50700831-50700853 TCCAAAGGATGCTTGAGCATTGG - Intergenic
1175240057 20:57540540-57540562 TCATAAGGAAGGCTGAGGCTGGG - Intergenic
1175285240 20:57833388-57833410 TCCTAAGGAGGCCTGTTTCTGGG + Intergenic
1176044799 20:63086960-63086982 TCCACAGGAGGCGTGATTCTGGG + Intergenic
1179984972 21:44915317-44915339 CAAAAAGGAAGCCTGAGACTGGG - Intronic
1180112423 21:45667646-45667668 TCCCAAGGAAGCCCCAGTGTTGG - Intronic
1180203843 21:46244744-46244766 TGAGAAGGAAGCCTGAGACTTGG + Intronic
1182413856 22:30208560-30208582 TCCACAGTCAGCCAGAGTCTGGG - Intergenic
1182765256 22:32753649-32753671 TCCAAAGGAATCTTTATTCTTGG + Intronic
1183365000 22:37402291-37402313 TCCAAAGGCAGCCTGTGGTTCGG + Intronic
949505646 3:4724931-4724953 TCCAAAGTAACCCTGAGTGCAGG + Intronic
950854948 3:16096262-16096284 CCAAAAGGAAAGCTGAGTCTGGG + Intergenic
951501711 3:23395077-23395099 CCCATAAGAAGCCTGAGACTTGG + Intronic
951724595 3:25743163-25743185 TCCAAAAGAAGCATGGCTCTGGG + Intronic
954156359 3:48686859-48686881 TCCACAGGAAGCCCGAGCCCAGG + Intergenic
954178450 3:48862642-48862664 TCCTGAAGAAGCCTGAATCTGGG + Exonic
954888958 3:53905335-53905357 TCCCAAGGAAGCCTGGATGTTGG + Intergenic
957997746 3:87711725-87711747 TCCCAAGGAAGCATGTGTCCAGG - Intergenic
965360886 3:167735988-167736010 GCAAAAGGAAGCTTGACTCTGGG + Exonic
968161806 3:196432683-196432705 TCCGAAGGAAGCTTCGGTCTCGG + Intergenic
968633921 4:1667970-1667992 TCCCAAGGGAGCCTCTGTCTTGG - Intronic
970205806 4:13654525-13654547 TGCAAAGGGAGGCTGAGTCCCGG - Intergenic
971027798 4:22605810-22605832 TCCAAAGGAAGAGTGAGTATAGG - Intergenic
971895937 4:32593951-32593973 ACTGAAGGAAGACTGAGTCTGGG + Intergenic
972346375 4:38195960-38195982 TACAAAGGAAGCTTGTGTCTTGG + Intergenic
972679775 4:41294173-41294195 TCCAGAGGAAGGCTGGGACTTGG + Intergenic
974018825 4:56675199-56675221 CCCACAGGAACCCTGAGTCACGG + Intronic
975333469 4:73147368-73147390 TCCACAGCAAGCCAGAGTCAAGG + Exonic
975973936 4:80073465-80073487 TCCCATGGAATCCTTAGTCTTGG - Intronic
976630055 4:87227410-87227432 GACAAAGGAAGCTTGAGTCCAGG + Intronic
978115217 4:105011774-105011796 GCAAAAGTAAGCCTGAGTTTGGG + Intergenic
978372047 4:108038903-108038925 TTCAGAGCAGGCCTGAGTCTTGG + Intergenic
981027746 4:140093865-140093887 TCCAAAGGAAATCTCAGGCTAGG - Intronic
985031133 4:185791825-185791847 TTAAAAGGAATCCAGAGTCTTGG - Intronic
986587034 5:9329186-9329208 TCCAAGGGAAGCCTGAGTAAAGG - Intronic
995250240 5:109984729-109984751 TACAAAGGATACCTGAGACTGGG - Intergenic
997504022 5:134401696-134401718 TCTGGAGGAAGCCTGAGGCTTGG - Intergenic
998928212 5:147151321-147151343 TGAAAAGGCAGCCTGAGTATTGG + Intergenic
1001250597 5:170143964-170143986 TCCAAAGCCAGCCTTGGTCTGGG - Intergenic
1002254630 5:177950010-177950032 TCAAAACGATGCCTCAGTCTAGG - Intergenic
1005955418 6:30660048-30660070 TCCACAGGAAACCTGCGTCCGGG + Exonic
1006119254 6:31794343-31794365 TCCAAAGGAGACCTGTGCCTTGG - Intronic
1007534800 6:42576845-42576867 TCCAAAGTAAGCCTTGTTCTAGG + Intronic
1008196730 6:48533730-48533752 TCCAAAGTAAGCCCGTGACTGGG + Intergenic
1008501739 6:52190392-52190414 TCCAAAGGAAGCCTGAGTCTAGG - Exonic
1018222514 6:161595305-161595327 TCCAAAGGAACCCACAGTGTGGG + Intronic
1018915992 6:168132687-168132709 TCAACAGGAAGCCCGATTCTGGG - Intergenic
1019434803 7:1017171-1017193 TCCCCAGGGAGCCTGAGCCTGGG - Intronic
1023852857 7:44159795-44159817 CCCAAAGCAAGCCTGAGGCCTGG - Intronic
1025019811 7:55472201-55472223 TCCAAGGCAAGCCTGATTCTAGG + Exonic
1026311408 7:69188036-69188058 ATCACAGGAAGCCAGAGTCTTGG + Intergenic
1028999618 7:97139332-97139354 TCCAAAATACGGCTGAGTCTGGG + Intronic
1029515677 7:101021640-101021662 TACAAAGGCAGACTGAGGCTAGG - Intronic
1029633159 7:101765932-101765954 TATAAAGGATGCCTGAGCCTGGG - Intergenic
1031881638 7:127205384-127205406 TTCAAAGAAAGCCCGAGTCTTGG - Intronic
1033719125 7:144038218-144038240 ACCAGAGGTAGCCTGAGTCTGGG - Intergenic
1034116888 7:148591477-148591499 TCCACAGGAAGCCTCTATCTTGG + Intronic
1037150818 8:15633463-15633485 TCCAAATGAGGCCACAGTCTGGG - Intronic
1041094287 8:54333559-54333581 TCCAAGAAAGGCCTGAGTCTTGG + Intergenic
1046954260 8:120046997-120047019 TCCCAGAGAAGCCAGAGTCTGGG + Intronic
1049431603 8:142567745-142567767 TCTAAGGGAGGCCTGAGCCTGGG - Intergenic
1049710925 8:144062976-144062998 GCCAAGGGAGGCCTGAGCCTGGG - Intronic
1050127024 9:2367897-2367919 CCCAAAGGCAGCCTTACTCTGGG - Intergenic
1051325696 9:15965353-15965375 TACAAAATAAGCCTGAGGCTAGG + Intronic
1051518902 9:17961868-17961890 TGAAAAGGAACCCTGATTCTTGG - Intergenic
1052172143 9:25412798-25412820 CCCTAAGGAAGCCTGTCTCTGGG + Intergenic
1053045399 9:34911934-34911956 TCCAAAGGCAACCTGAGTCGGGG + Intergenic
1053064268 9:35056550-35056572 TCAAAATGGAGCCTGAGTCCTGG - Exonic
1055893839 9:81152749-81152771 TTAAAAGGATGCCTGAGACTGGG + Intergenic
1057894955 9:98901835-98901857 TGCAAAGGAAACCTGAGGGTGGG + Intergenic
1059290175 9:113216220-113216242 TCCAAAGGCATCCTTAGTTTAGG + Intronic
1059473088 9:114522099-114522121 TCCAATAGGAGCCTGGGTCTTGG - Intergenic
1060663569 9:125419135-125419157 TCCAAAAGAAGCCAGACTCAGGG - Intergenic
1061168120 9:128936356-128936378 GTCAAAGTAAGCCTGAGTGTGGG + Intronic
1061572010 9:131483700-131483722 AGAAAAGGCAGCCTGAGTCTGGG - Intronic
1062491090 9:136805229-136805251 TCTGAAGGATGCCTGTGTCTTGG + Intronic
1189483193 X:41408736-41408758 TCAAAAGTGAGCCTGAATCTCGG + Intergenic
1192188969 X:68979103-68979125 TCCAAAGGAAGCCTGTGAATGGG + Intergenic
1192799905 X:74456005-74456027 TCCCAAGGAAGTCCCAGTCTAGG + Intronic
1200076685 X:153554709-153554731 GCCATAGGAAGCCTGTGGCTGGG + Intronic
1200845385 Y:7827273-7827295 TCTAAAGGAACCCTGAGCCATGG - Intergenic
1201399704 Y:13592171-13592193 CCCAAAGGGAGCCTTCGTCTAGG + Intergenic