ID: 1008505796

View in Genome Browser
Species Human (GRCh38)
Location 6:52228463-52228485
Sequence AAGTCTCTCTGGCCGTATAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008505793_1008505796 -2 Left 1008505793 6:52228442-52228464 CCTTGATTAATTACATCTGCAAA No data
Right 1008505796 6:52228463-52228485 AAGTCTCTCTGGCCGTATAAGGG No data
1008505792_1008505796 10 Left 1008505792 6:52228430-52228452 CCATCTCAAAATCCTTGATTAAT No data
Right 1008505796 6:52228463-52228485 AAGTCTCTCTGGCCGTATAAGGG No data
1008505790_1008505796 12 Left 1008505790 6:52228428-52228450 CCCCATCTCAAAATCCTTGATTA No data
Right 1008505796 6:52228463-52228485 AAGTCTCTCTGGCCGTATAAGGG No data
1008505791_1008505796 11 Left 1008505791 6:52228429-52228451 CCCATCTCAAAATCCTTGATTAA No data
Right 1008505796 6:52228463-52228485 AAGTCTCTCTGGCCGTATAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008505796 Original CRISPR AAGTCTCTCTGGCCGTATAA GGG Intergenic
No off target data available for this crispr