ID: 1008507898

View in Genome Browser
Species Human (GRCh38)
Location 6:52248518-52248540
Sequence AGGATTGCACAGGCATGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008507898_1008507903 -7 Left 1008507898 6:52248518-52248540 CCCCTCCATGCCTGTGCAATCCT No data
Right 1008507903 6:52248534-52248556 CAATCCTCTGCAGCTCTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008507898 Original CRISPR AGGATTGCACAGGCATGGAG GGG (reversed) Intergenic
No off target data available for this crispr