ID: 1008508418

View in Genome Browser
Species Human (GRCh38)
Location 6:52253640-52253662
Sequence CGGGCTGGCAGCAACTCCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008508412_1008508418 5 Left 1008508412 6:52253612-52253634 CCGTGGGCGTGGTCTGTCCTTGC No data
Right 1008508418 6:52253640-52253662 CGGGCTGGCAGCAACTCCTCAGG No data
1008508411_1008508418 8 Left 1008508411 6:52253609-52253631 CCTCCGTGGGCGTGGTCTGTCCT No data
Right 1008508418 6:52253640-52253662 CGGGCTGGCAGCAACTCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008508418 Original CRISPR CGGGCTGGCAGCAACTCCTC AGG Intergenic
No off target data available for this crispr