ID: 1008508716

View in Genome Browser
Species Human (GRCh38)
Location 6:52256215-52256237
Sequence ATGTGGGGCTGGAGAGCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008508716_1008508726 24 Left 1008508716 6:52256215-52256237 CCATCTGCTCTCCAGCCCCACAT No data
Right 1008508726 6:52256262-52256284 ACTTCCATGAAACCAGTCCCTGG No data
1008508716_1008508720 -8 Left 1008508716 6:52256215-52256237 CCATCTGCTCTCCAGCCCCACAT No data
Right 1008508720 6:52256230-52256252 CCCCACATTCACCCTTGGACTGG No data
1008508716_1008508722 -7 Left 1008508716 6:52256215-52256237 CCATCTGCTCTCCAGCCCCACAT No data
Right 1008508722 6:52256231-52256253 CCCACATTCACCCTTGGACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008508716 Original CRISPR ATGTGGGGCTGGAGAGCAGA TGG (reversed) Intergenic
No off target data available for this crispr